DNASU Plasmid Repository • 480.965.5697 | Email

Rad51 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  RAD51
Gene Name:  RAD51 recombinase
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH272292.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: Clone insert was fully sequence-verified by the clone submitter but the sequence is not available.
Discrepancy :
Unknown / Unknown
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1020nts         Open reading frame : 1 to 1020
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1252
Start on reference sequence 233
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : RAD51
Symbol Nomenclature : RAD51
SYNONYM : BRCC5; HRAD51; HsRad51; HsT16930; MRMV2; RAD51A; RECA
Designation : BRCA1/BRCA2-containing complex, subunit 5|DNA repair protein RAD51 homolog 1|RAD51 homolog A|RecA, E. coli, homolog of|RecA-like protein|recombination protein A
Full Nomenclature : RAD51 recombinase
GENEID : 5888
HGNC : 9817
MIM : 179617
Vega : OTTHUMG00000130067
Target GenBank: D14134.1


Reference Sequence Alignment




















NCI : ATR signaling pathway
NCI : BARD1 signaling events
NCI : p73 transcription factor network
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : miRNA regulation of DNA Damage Response


SMART domain : AAA : ATPases associated with a variety of cellular activities
UniProt : Q6ZNA8
UniProt : B0FXP0
UniProt : Q06609
HPRD : 01557


Cloning Information : 272292
HIP Master Clone ID : 202655
Original Clone ID : FLH272292.01L


TAX_ID : 9606
Species Specific ID: 5888


Chromosome : 15
Map Location : 15q15.1
Ensembl : ENSG00000051180


Labome : RAD51-antibody