DNASU Plasmid Repository • 480.965.5697 | Email

FGF16 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FGF16
Gene Name:  fibroblast growth factor 16
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH272326.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: Clone insert was fully sequence-verified by the clone submitter but the sequence is not available.
Mutation/
Discrepancy :
Unknown / Unknown
Publications: None
Authors: HIP
HsCD00305229

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 624nts         Open reading frame : 1 to 624
Reference Sequence Alignment

ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCG
TCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAA
ATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTGAAGGGGATCCTG
CGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACG
GTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCT
GTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGA
GGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAA
GAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAG
TATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACAC
CAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCC
AGAGACCTCTTTCACTATAGGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 624
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FGF16
Symbol Nomenclature : FGF16
SYNONYM : FGF-16; MF4
Designation : metacarpal 4-5 fusion
Full Nomenclature : fibroblast growth factor 16
GENEID : 8823
Locus Tag : XX-FW80732C2.1
HGNC : 3672
MIM : 300827
Target GenBank: NM_003868.1

 

Reference Sequence Alignment

  

HsCD00305229      ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCG
NM_003868.1       ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCG
                  ************************************************************

HsCD00305229      TCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAA
NM_003868.1       TCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAA
                  ************************************************************

HsCD00305229      ATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTGAAGGGGATCCTG
NM_003868.1       ATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTGAAGGGGATCCTG
                  ************************************************************

HsCD00305229      CGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACG
NM_003868.1       CGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACG
                  ************************************************************

HsCD00305229      GTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCT
NM_003868.1       GTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCT
                  ************************************************************

HsCD00305229      GTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGA
NM_003868.1       GTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGA
                  ************************************************************

HsCD00305229      GGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAA
NM_003868.1       GGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAA
                  ************************************************************

HsCD00305229      GAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAG
NM_003868.1       GAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAG
                  ************************************************************

HsCD00305229      TATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACAC
NM_003868.1       TATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACAC
                  ************************************************************

HsCD00305229      CAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCC
NM_003868.1       CAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCC
                  ************************************************************

HsCD00305229      AGAGACCTCTTTCACTATAGGTAA
NM_003868.1       AGAGACCTCTTTCACTATAGGTAA
                  ************************

Pathways

Reactome : Activated point mutants of FGFR2
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FGFR ligand binding and activation
Reactome : FGFR2 ligand binding and activation
Reactome : FGFR2c ligand binding and activation
Reactome : FGFR3 ligand binding and activation
Reactome : FGFR3c ligand binding and activation
Reactome : FGFR4 ligand binding and activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR2 mutants
Reactome : Signaling by FGFR3 mutants
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by activated point mutants of FGFR3
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF

Protein

SMART domain : FGF : Acidic and basic fibroblast growth factor family.
UniProt : O43320
HPRD : 04764

Clone

Cloning Information : 272326
HIP Master Clone ID : 202689
Original Clone ID : FLH272326.01L

Organism


TAX_ID : 9606
Species Specific ID: 8823

Genome

Chromosome : X
Map Location : Xq13

Reagents

Labome : FGF16-antibody