DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol: 
Gene Name:  None
Sequence             
Original Clone ID: 11222b2BCt3p1
Keyword: None
Species: Streptomyces avermitilis MA-4680
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "C-terminal 6-His, TOPO"
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
SaCD00306194

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 861nts         Open reading frame : 51 to 911

TCCTCTGAATATTTTGTTTACTTTAAGAAGGAGATATACATATGTCCCTTGCACGCCGAG
TGGGGATCTACACCCGCATCTCGCGGGACGACGAGGGCGATGCGCTGGGTGTAGCCCGCC
AGCACCGAGACTGCGAGCGACTTGCAGATCTCCGTTCCTGGCAGGCCGTGAAGGTCTATG
AGGACAACGACGTATCGGCCTACAAGCGCCACGTCGTACGCGAGCAGTTCGAACTGATGC
TGAGCGACCTAGGCGCCGGCCTCATCGACGGCATCGTGGCGTACGACCTAGACAGGCTCG
CGCGGCAGCCGCGAGACCTCGAGCGGCTGATCGAGATCTTCGATGAGCGCCCACGGCTGG
AGTTCGCGACGGTCACCAACGACGTCAACCTCGGAACGCCGGACGGCCGCACCATGTCGC
GCATCATGGTCGCCTTCGCCAACAAGTCGTCGCACGATGCCTCGCGCCGCATCAAGCGCA
AGCATCTGGAGTTGGCCCAGCAAGGCAAGGACAGCGGCGGACCGGCACCCTACGGATGGC
TCAAGGAAGACCGAAGCAAGGTCGACCCGAAAGCAGCCGCAGCCATCCGGGAGGCCCAGC
GCGAAATCCTTGCCGGCGTTCGCATCGGCACGATCCGTACGCGCTGGCAGGAGCAGGGCC
TGGGCAACCCCCGCGCAGGTACCAAGCGGATGGCTCACCACCACGTCGAGCACATCCTCA
CGAGCCCACGACTGGTCGGATACCGGACCTATCACGGCGAGGTCCTGAACGACGAGGACG
GCCGACCCGTCATGGGCGAGTGGGAAGCGATCAACACGCTCGAAGAATGGGAAGCGGTGT
GCGCCGCAGTTGCCGAGCGAAAGCAGAAGCAGCCCGGCAGGTCGGAAGGGCATCATCACC
ATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 861
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: SolubleProtein: Protein_Soluble
ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
Find experimental protocols in NYSGXRC-11222b
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Reagents

Gene

Target GenBank: NP_825645.1

 

Protein

SMART domain : Resolvase : Resolvase, N terminal domain
Structural Annotation Wiki : TOPSAN
UniProt : Q82EZ5

Clone

Cloning Information : 500353
HIP Master Clone ID : 411705
Original Clone ID : 11222b2BCt3p1

Experimental

TargetTrack - Experimental data : NYSGXRC-11222b

Reagents

Labome : int11-cDNA