DNASU Plasmid Repository • 480.965.5697 | Email

BUB3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BUB3
Gene Name:  BUB3 mitotic checkpoint protein
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH017971.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003076

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 987nts         Open reading frame : 1 to 987
Reference Sequence Alignment

ATGACCGGTTCTAACGAGTTCAAGCTGAACCAGCCACCCGAGGATGGCATCTCCTCCGTG
AAGTTCAGCCCCAACACCTCCCAGTTCCTGCTTGTCTCCTCCTGGGACACGTCCGTGCGT
CTCTACGATGTGCCGGCCAACTCCATGCGGCTCAAGTACCAGCACACCGGCGCCGTCCTG
GACTGCGCCTTCTACGATCCAACGCATGCCTGGAGTGGAGGACTAGATCATCAATTGAAA
ATGCATGATTTGAACACTGATCAAGAAAATCTTGTTGGGACCCATGATGCCCCTATCAGA
TGTGTTGAATACTGTCCAGAAGTGAATGTGATGGTCACTGGAAGTTGGGATCAGACAGTT
AAACTGTGGGATCCCAGAACTCCTTGTAATGCTGGGACCTTCTCTCAGCCTGAAAAGGTA
TATACCCTCTCAGTGTCTGGAGACCGGCTGATTGTGGGAACAGCAGGCCGCAGAGTGTTG
GTGTGGGACTTACGGAACATGGGTTACGTGCAGCAGCGCAGGGAGTCCAGCCTGAAATAC
CAGACTCGCTGCATACGAGCGTTTCCAAACAAGCAGGGTTATGTATTAAGCTCTATTGAA
GGCCGAGTGGCAGTTGAGTATTTGGACCCAAGCCCTGAGGTACAGAAGAAGAAGTATGCC
TTCAAATGTCACAGACTAAAAGAAAATAATATTGAGCAGATTTACCCAGTCAATGCCATT
TCTTTTCACAATATCCACAATACATTTGCCACAGGTGGTTCTGATGGCTTTGTAAATATT
TGGGATCCATTTAACAAAAAGCGACTGTGCCAATTCCATCGGTACCCCACGAGCATCGCA
TCACTTGCCTTCAGTAATGATGGGACTACGCTTGCAATAGCGTCATCATATATGTATGAA
ATGGATGACACAGAACATCCTGAAGATGGTATCTTCATTCGCCAAGTGACAGATGCAGAA
ACAAAACCCAAGTCACCATGTACTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1067
Start on reference sequence 81
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BUB3
Symbol Nomenclature : BUB3
SYNONYM : BUB3L; hBUB3
Designation : BUB3 budding uninhibited by benzimidazoles 3 homolog|budding uninhibited by benomyl|budding uninhibited by benzimidazoles 3 homolog|mitotic checkpoint component|mitotic checkpoint protein BUB3
Full Nomenclature : BUB3 mitotic checkpoint protein
GENEID : 9184
GI : 61372580
GenBank Accession : AY891942
HGNC : 1151
MIM : 603719
Vega : OTTHUMG00000019197
Target GenBank: BC005138

 

Reference Sequence Alignment

  

HsCD00003076        ATGACCGGTTCTAACGAGTTCAAGCTGAACCAGCCACCCGAGGATGGCATCTCCTCCGTG
NM_004725.3         ATGACCGGTTCTAACGAGTTCAAGCTGAACCAGCCACCCGAGGATGGCATCTCCTCCGTG
NM_001007793.2      ATGACCGGTTCTAACGAGTTCAAGCTGAACCAGCCACCCGAGGATGGCATCTCCTCCGTG
                    ************************************************************

HsCD00003076        AAGTTCAGCCCCAACACCTCCCAGTTCCTGCTTGTCTCCTCCTGGGACACGTCCGTGCGT
NM_004725.3         AAGTTCAGCCCCAACACCTCCCAGTTCCTGCTTGTCTCCTCCTGGGACACGTCCGTGCGT
NM_001007793.2      AAGTTCAGCCCCAACACCTCCCAGTTCCTGCTTGTCTCCTCCTGGGACACGTCCGTGCGT
                    ************************************************************

HsCD00003076        CTCTACGATGTGCCGGCCAACTCCATGCGGCTCAAGTACCAGCACACCGGCGCCGTCCTG
NM_004725.3         CTCTACGATGTGCCGGCCAACTCCATGCGGCTCAAGTACCAGCACACCGGCGCCGTCCTG
NM_001007793.2      CTCTACGATGTGCCGGCCAACTCCATGCGGCTCAAGTACCAGCACACCGGCGCCGTCCTG
                    ************************************************************

HsCD00003076        GACTGCGCCTTCTACGATCCAACGCATGCCTGGAGTGGAGGACTAGATCATCAATTGAAA
NM_004725.3         GACTGCGCCTTCTACGATCCAACGCATGCCTGGAGTGGAGGACTAGATCATCAATTGAAA
NM_001007793.2      GACTGCGCCTTCTACGATCCAACGCATGCCTGGAGTGGAGGACTAGATCATCAATTGAAA
                    ************************************************************

HsCD00003076        ATGCATGATTTGAACACTGATCAAGAAAATCTTGTTGGGACCCATGATGCCCCTATCAGA
NM_004725.3         ATGCATGATTTGAACACTGATCAAGAAAATCTTGTTGGGACCCATGATGCCCCTATCAGA
NM_001007793.2      ATGCATGATTTGAACACTGATCAAGAAAATCTTGTTGGGACCCATGATGCCCCTATCAGA
                    ************************************************************

HsCD00003076        TGTGTTGAATACTGTCCAGAAGTGAATGTGATGGTCACTGGAAGTTGGGATCAGACAGTT
NM_004725.3         TGTGTTGAATACTGTCCAGAAGTGAATGTGATGGTCACTGGAAGTTGGGATCAGACAGTT
NM_001007793.2      TGTGTTGAATACTGTCCAGAAGTGAATGTGATGGTCACTGGAAGTTGGGATCAGACAGTT
                    ************************************************************

HsCD00003076        AAACTGTGGGATCCCAGAACTCCTTGTAATGCTGGGACCTTCTCTCAGCCTGAAAAGGTA
NM_004725.3         AAACTGTGGGATCCCAGAACTCCTTGTAATGCTGGGACCTTCTCTCAGCCTGAAAAGGTA
NM_001007793.2      AAACTGTGGGATCCCAGAACTCCTTGTAATGCTGGGACCTTCTCTCAGCCTGAAAAGGTA
                    ************************************************************

HsCD00003076        TATACCCTCTCAGTGTCTGGAGACCGGCTGATTGTGGGAACAGCAGGCCGCAGAGTGTTG
NM_004725.3         TATACCCTCTCAGTGTCTGGAGACCGGCTGATTGTGGGAACAGCAGGCCGCAGAGTGTTG
NM_001007793.2      TATACCCTCTCAGTGTCTGGAGACCGGCTGATTGTGGGAACAGCAGGCCGCAGAGTGTTG
                    ************************************************************

HsCD00003076        GTGTGGGACTTACGGAACATGGGTTACGTGCAGCAGCGCAGGGAGTCCAGCCTGAAATAC
NM_004725.3         GTGTGGGACTTACGGAACATGGGTTACGTGCAGCAGCGCAGGGAGTCCAGCCTGAAATAC
NM_001007793.2      GTGTGGGACTTACGGAACATGGGTTACGTGCAGCAGCGCAGGGAGTCCAGCCTGAAATAC
                    ************************************************************

HsCD00003076        CAGACTCGCTGCATACGAGCGTTTCCAAACAAGCAGGGTTATGTATTAAGCTCTATTGAA
NM_004725.3         CAGACTCGCTGCATACGAGCGTTTCCAAACAAGCAGGGTTATGTATTAAGCTCTATTGAA
NM_001007793.2      CAGACTCGCTGCATACGAGCGTTTCCAAACAAGCAGGGTTATGTATTAAGCTCTATTGAA
                    ************************************************************

HsCD00003076        GGCCGAGTGGCAGTTGAGTATTTGGACCCAAGCCCTGAGGTACAGAAGAAGAAGTATGCC
NM_004725.3         GGCCGAGTGGCAGTTGAGTATTTGGACCCAAGCCCTGAGGTACAGAAGAAGAAGTATGCC
NM_001007793.2      GGCCGAGTGGCAGTTGAGTATTTGGACCCAAGCCCTGAGGTACAGAAGAAGAAGTATGCC
                    ************************************************************

HsCD00003076        TTCAAATGTCACAGACTAAAAGAAAATAATATTGAGCAGATTTACCCAGTCAATGCCATT
NM_004725.3         TTCAAATGTCACAGACTAAAAGAAAATAATATTGAGCAGATTTACCCAGTCAATGCCATT
NM_001007793.2      TTCAAATGTCACAGACTAAAAGAAAATAATATTGAGCAGATTTACCCAGTCAATGCCATT
                    ************************************************************

HsCD00003076        TCTTTTCACAATATCCACAATACATTTGCCACAGGTGGTTCTGATGGCTTTGTAAATATT
NM_004725.3         TCTTTTCACAATATCCACAATACATTTGCCACAGGTGGTTCTGATGGCTTTGTAAATATT
NM_001007793.2      TCTTTTCACAATATCCACAATACATTTGCCACAGGTGGTTCTGATGGCTTTGTAAATATT
                    ************************************************************

HsCD00003076        TGGGATCCATTTAACAAAAAGCGACTGTGCCAATTCCATCGGTACCCCACGAGCATCGCA
NM_004725.3         TGGGATCCATTTAACAAAAAGCGACTGTGCCAATTCCATCGGTACCCCACGAGCATCGCA
NM_001007793.2      TGGGATCCATTTAACAAAAAGCGACTGTGCCAATTCCATCGGTACCCCACGAGCATCGCA
                    ************************************************************

HsCD00003076        TCACTTGCCTTCAGTAATGATGGGACTACGCTTGCAATAGCGTCATCATATATGTATGAA
NM_004725.3         TCACTTGCCTTCAGTAATGATGGGACTACGCTTGCAATAGCGTCATCATATATGTATGAA
NM_001007793.2      TCACTTGCCTTCAGTAATGATGGGACTACGCTTGCAATAGCGTCATCATATATGTATGAA
                    ************************************************************

HsCD00003076        ATGGATGACACAGAACATCCTGAAGATGGTATCTTCATTCGCCAAGTGACAGATGCAGAA
NM_004725.3         ATGGATGACACAGAACATCCTGAAGATGGTATCTTCATTCGCCAAGTGACAGATGCAGAA
NM_001007793.2      ATGGATGACACAGAACATCCTGAAGATGGTATCTTCATTCGCCAAGTGACAGATGCAGAA
                    ************************************************************

HsCD00003076        ACAAAACCCAAGTCACCATGTACTTTG
NM_004725.3         ACAAAACCCAAGTCACCATGTACTTGA
NM_001007793.2      ACAAAACCCAAGTCCACCTAA------
                    **************..*.*.:      

Pathways

NCI : p73 transcription factor network
Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Inactivation of APC/C via direct inhibition of the APC/C complex
Reactome : Inhibition of the proteolytic activity of APC/C required for the onset of anaphase by mitotic spindle checkpoint components
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Mitotic Spindle Checkpoint
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle

Protein

SMART domain : WD40 : WD40 repeats
UniProt : O43684
HPRD : 04761

Clone

Cloning Information : 17971
HIP Master Clone ID : 32170
Original Clone ID : FLH017971.01L

Organism


TAX_ID : 9606
Species Specific ID: 9184

Genome

Chromosome : 10
Map Location : 10q26
Ensembl : ENSG00000154473

Reagents

Labome : BUB3-antibody