DNASU Plasmid Repository • 480.965.5697 | Email

PRKCA (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKCA
Gene Name:  protein kinase C, alpha
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH058126.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000308

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2019nts         Open reading frame : 1 to 2019
Reference Sequence Alignment

ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTC
GCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATC
GCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGGTTT
GGGAAACAAGGCTTCCAGTGCCAAGTTTGCTGTTTTGTGGTCCACAAGAGGTGCCATGAA
TTTGTTACTTTTTCTTGTCCGGGTGCGGATAAGGGACCCGACACTGATGACCCCAGGAGC
AAGCACAAGTTCAAAATCCACACTTACGGAAGCCCCACCTTCTGCGATCACTGTGGGTCA
CTGCTCTATGGACTTATCCATCAAGGGATGAAATGTGACACCTGCGATATGAACGTTCAC
AAGCAATGCGTCATCAATGTCCCCAGCCTCTGCGGAATGGATCACACTGAGAAGAGGGGG
CGGATTTACCTAAAGGCTGAGGTTGCTGATGAAAAGCTCCATGTCACAGTACGAGATGCA
AAAAATCTAATCCCTATGGATCCAAACGGGCTTTCAGATCCTTATGTGAAGCTGAAACTT
ATTCCTGATCCCAAGAATGAAAGCAAGCAAAAAACCAAAACCATCCGCTCCACACTAAAT
CCGCAGTGGAATGAGTCCTTTACATTCAAATTGAAACCTTCAGACAAAGACCGACGACTG
TCTGTAGAAATCTGGGACTGGGATCGAACAACAAGGAATGACTTCATGGGATCCCTTTCC
TTTGGAGTTTCGGAGCTGATGAAGATGCCGGCCAGTGGATGGTACAAGTTGCTTAACCAA
GAAGAAGGTGAGTACTACAACGTACCCATTCCGGAAGGGGACGAGGAAGGAAACATGGAA
CTCAGGCAGAAATTCGAGAAAGCCAAACTTGGCCCTGCTGGCAACAAAGTCATCAGTCCC
TCTGAAGACAGGAAACAACCTTCCAACAACCTTGACCGAGTGAAACTCACGGACTTCAAT
TTCCTCATGGTGTTGGGAAAGGGGAGTTTTGGAAAGGTGATGCTTGCCGACAGGAAGGGC
ACAGAAGAACTGTATGCAATCAAAATCCTGAAGAAGGATGTGGTGATTCAGGATGATGAC
GTGGAGTGCACCATGGTAGAAAAGCGAGTCTTGGCCCTGCTTGACAAACCCCCGTTCTTG
ACGCAGCTGCACTCCTGCTTCCAGACAGTGGATCGGCTGTACTTCGTCATGGAATATGTC
AACGGTGGGGACCTCATGTACCACATTCAGCAAGTAGGAAAATTTAAGGAACCACAAGCA
GTATTCTATGCGGCAGAGATTTCCATCGGATTGTTCTTTCTTCATAAAAGAGGAATCATT
TATAGGGATCTGAAGTTAGATAACGTCATGTTGGATTCAGAAGGACATATCAAAATTGCT
GACTTTGGGATGTGCAAGGAACACATGATGGATGGAGTCACGACCAGGACCTTCTGTGGG
ACTCCAGATTATATCGCCCCAGAGATAATCGCTTATCAGCCGTATGGAAAATCTGTGGAC
TGGTGGGCCTATGGCGTCCTGTTGTATGAAATGCTTGCCGGGCAGCCTCCATTTGATGGT
GAAGATGAAGACGAGCTATTTCAGTCTATCATGGAGCACAACGTTTCCTATCCAAAATCC
TTGTCCAAGGAGGCTGTTTCTATCTGCAAAGGACTGATGACCAAACACCCAGCCAAGCGG
CTGGGCTGTGGGCCTGAGGGGGAGAGGGACGTGAGAGAGCATGCCTTCTTCCGGAGGATC
GACTGGGAAAAACTGGAGAACAGGGAGATCCAGCCACCATTCAAGCCCAAAGTGTGTGGC
AAAGGAGCAGAGAACTTTGACAAGTTCTTCACACGAGGACAGCCCGTCTTAACACCACCT
GATCAGCTGGTTATTGCTAACATAGACCAGTCTGATTTTGAAGGGTTCTCGTATGTCAAC
CCCCAGTTTGTGCACCCCATCTTACAGAGTGCAGTATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2046
Start on reference sequence 28
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKCA
Symbol Nomenclature : PRKCA
SYNONYM : AAG6; PKC-alpha; PKCA; PRKACA
Designation : PKC-A|aging-associated gene 6|protein kinase C alpha type
Full Nomenclature : protein kinase C, alpha
GENEID : 5578
GI : 60826236
GenBank Accession : AY893713
HGNC : 9393
MIM : 176960
Vega : OTTHUMG00000179533
Target GenBank: NM_002737

 

Reference Sequence Alignment

  

HsCD00000308      ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTC
NM_002737.2       ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTC
                  ************************************************************

HsCD00000308      GCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATC
NM_002737.2       GCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATC
                  ************************************************************

HsCD00000308      GCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGGTTT
NM_002737.2       GCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGGTTT
                  ************************************************************

HsCD00000308      GGGAAACAAGGCTTCCAGTGCCAAGTTTGCTGTTTTGTGGTCCACAAGAGGTGCCATGAA
NM_002737.2       GGGAAACAAGGCTTCCAGTGCCAAGTTTGCTGTTTTGTGGTCCACAAGAGGTGCCATGAA
                  ************************************************************

HsCD00000308      TTTGTTACTTTTTCTTGTCCGGGTGCGGATAAGGGACCCGACACTGATGACCCCAGGAGC
NM_002737.2       TTTGTTACTTTTTCTTGTCCGGGTGCGGATAAGGGACCCGACACTGATGACCCCAGGAGC
                  ************************************************************

HsCD00000308      AAGCACAAGTTCAAAATCCACACTTACGGAAGCCCCACCTTCTGCGATCACTGTGGGTCA
NM_002737.2       AAGCACAAGTTCAAAATCCACACTTACGGAAGCCCCACCTTCTGCGATCACTGTGGGTCA
                  ************************************************************

HsCD00000308      CTGCTCTATGGACTTATCCATCAAGGGATGAAATGTGACACCTGCGATATGAACGTTCAC
NM_002737.2       CTGCTCTATGGACTTATCCATCAAGGGATGAAATGTGACACCTGCGATATGAACGTTCAC
                  ************************************************************

HsCD00000308      AAGCAATGCGTCATCAATGTCCCCAGCCTCTGCGGAATGGATCACACTGAGAAGAGGGGG
NM_002737.2       AAGCAATGCGTCATCAATGTCCCCAGCCTCTGCGGAATGGATCACACTGAGAAGAGGGGG
                  ************************************************************

HsCD00000308      CGGATTTACCTAAAGGCTGAGGTTGCTGATGAAAAGCTCCATGTCACAGTACGAGATGCA
NM_002737.2       CGGATTTACCTAAAGGCTGAGGTTGCTGATGAAAAGCTCCATGTCACAGTACGAGATGCA
                  ************************************************************

HsCD00000308      AAAAATCTAATCCCTATGGATCCAAACGGGCTTTCAGATCCTTATGTGAAGCTGAAACTT
NM_002737.2       AAAAATCTAATCCCTATGGATCCAAACGGGCTTTCAGATCCTTATGTGAAGCTGAAACTT
                  ************************************************************

HsCD00000308      ATTCCTGATCCCAAGAATGAAAGCAAGCAAAAAACCAAAACCATCCGCTCCACACTAAAT
NM_002737.2       ATTCCTGATCCCAAGAATGAAAGCAAGCAAAAAACCAAAACCATCCGCTCCACACTAAAT
                  ************************************************************

HsCD00000308      CCGCAGTGGAATGAGTCCTTTACATTCAAATTGAAACCTTCAGACAAAGACCGACGACTG
NM_002737.2       CCGCAGTGGAATGAGTCCTTTACATTCAAATTGAAACCTTCAGACAAAGACCGACGACTG
                  ************************************************************

HsCD00000308      TCTGTAGAAATCTGGGACTGGGATCGAACAACAAGGAATGACTTCATGGGATCCCTTTCC
NM_002737.2       TCTGTAGAAATCTGGGACTGGGATCGAACAACAAGGAATGACTTCATGGGATCCCTTTCC
                  ************************************************************

HsCD00000308      TTTGGAGTTTCGGAGCTGATGAAGATGCCGGCCAGTGGATGGTACAAGTTGCTTAACCAA
NM_002737.2       TTTGGAGTTTCGGAGCTGATGAAGATGCCGGCCAGTGGATGGTACAAGTTGCTTAACCAA
                  ************************************************************

HsCD00000308      GAAGAAGGTGAGTACTACAACGTACCCATTCCGGAAGGGGACGAGGAAGGAAACATGGAA
NM_002737.2       GAAGAAGGTGAGTACTACAACGTACCCATTCCGGAAGGGGACGAGGAAGGAAACATGGAA
                  ************************************************************

HsCD00000308      CTCAGGCAGAAATTCGAGAAAGCCAAACTTGGCCCTGCTGGCAACAAAGTCATCAGTCCC
NM_002737.2       CTCAGGCAGAAATTCGAGAAAGCCAAACTTGGCCCTGCTGGCAACAAAGTCATCAGTCCC
                  ************************************************************

HsCD00000308      TCTGAAGACAGGAAACAACCTTCCAACAACCTTGACCGAGTGAAACTCACGGACTTCAAT
NM_002737.2       TCTGAAGACAGGAAACAACCTTCCAACAACCTTGACCGAGTGAAACTCACGGACTTCAAT
                  ************************************************************

HsCD00000308      TTCCTCATGGTGTTGGGAAAGGGGAGTTTTGGAAAGGTGATGCTTGCCGACAGGAAGGGC
NM_002737.2       TTCCTCATGGTGTTGGGAAAGGGGAGTTTTGGAAAGGTGATGCTTGCCGACAGGAAGGGC
                  ************************************************************

HsCD00000308      ACAGAAGAACTGTATGCAATCAAAATCCTGAAGAAGGATGTGGTGATTCAGGATGATGAC
NM_002737.2       ACAGAAGAACTGTATGCAATCAAAATCCTGAAGAAGGATGTGGTGATTCAGGATGATGAC
                  ************************************************************

HsCD00000308      GTGGAGTGCACCATGGTAGAAAAGCGAGTCTTGGCCCTGCTTGACAAACCCCCGTTCTTG
NM_002737.2       GTGGAGTGCACCATGGTAGAAAAGCGAGTCTTGGCCCTGCTTGACAAACCCCCGTTCTTG
                  ************************************************************

HsCD00000308      ACGCAGCTGCACTCCTGCTTCCAGACAGTGGATCGGCTGTACTTCGTCATGGAATATGTC
NM_002737.2       ACGCAGCTGCACTCCTGCTTCCAGACAGTGGATCGGCTGTACTTCGTCATGGAATATGTC
                  ************************************************************

HsCD00000308      AACGGTGGGGACCTCATGTACCACATTCAGCAAGTAGGAAAATTTAAGGAACCACAAGCA
NM_002737.2       AACGGTGGGGACCTCATGTACCACATTCAGCAAGTAGGAAAATTTAAGGAACCACAAGCA
                  ************************************************************

HsCD00000308      GTATTCTATGCGGCAGAGATTTCCATCGGATTGTTCTTTCTTCATAAAAGAGGAATCATT
NM_002737.2       GTATTCTATGCGGCAGAGATTTCCATCGGATTGTTCTTTCTTCATAAAAGAGGAATCATT
                  ************************************************************

HsCD00000308      TATAGGGATCTGAAGTTAGATAACGTCATGTTGGATTCAGAAGGACATATCAAAATTGCT
NM_002737.2       TATAGGGATCTGAAGTTAGATAACGTCATGTTGGATTCAGAAGGACATATCAAAATTGCT
                  ************************************************************

HsCD00000308      GACTTTGGGATGTGCAAGGAACACATGATGGATGGAGTCACGACCAGGACCTTCTGTGGG
NM_002737.2       GACTTTGGGATGTGCAAGGAACACATGATGGATGGAGTCACGACCAGGACCTTCTGTGGG
                  ************************************************************

HsCD00000308      ACTCCAGATTATATCGCCCCAGAGATAATCGCTTATCAGCCGTATGGAAAATCTGTGGAC
NM_002737.2       ACTCCAGATTATATCGCCCCAGAGATAATCGCTTATCAGCCGTATGGAAAATCTGTGGAC
                  ************************************************************

HsCD00000308      TGGTGGGCCTATGGCGTCCTGTTGTATGAAATGCTTGCCGGGCAGCCTCCATTTGATGGT
NM_002737.2       TGGTGGGCCTATGGCGTCCTGTTGTATGAAATGCTTGCCGGGCAGCCTCCATTTGATGGT
                  ************************************************************

HsCD00000308      GAAGATGAAGACGAGCTATTTCAGTCTATCATGGAGCACAACGTTTCCTATCCAAAATCC
NM_002737.2       GAAGATGAAGACGAGCTATTTCAGTCTATCATGGAGCACAACGTTTCCTATCCAAAATCC
                  ************************************************************

HsCD00000308      TTGTCCAAGGAGGCTGTTTCTATCTGCAAAGGACTGATGACCAAACACCCAGCCAAGCGG
NM_002737.2       TTGTCCAAGGAGGCTGTTTCTATCTGCAAAGGACTGATGACCAAACACCCAGCCAAGCGG
                  ************************************************************

HsCD00000308      CTGGGCTGTGGGCCTGAGGGGGAGAGGGACGTGAGAGAGCATGCCTTCTTCCGGAGGATC
NM_002737.2       CTGGGCTGTGGGCCTGAGGGGGAGAGGGACGTGAGAGAGCATGCCTTCTTCCGGAGGATC
                  ************************************************************

HsCD00000308      GACTGGGAAAAACTGGAGAACAGGGAGATCCAGCCACCATTCAAGCCCAAAGTGTGTGGC
NM_002737.2       GACTGGGAAAAACTGGAGAACAGGGAGATCCAGCCACCATTCAAGCCCAAAGTGTGTGGC
                  ************************************************************

HsCD00000308      AAAGGAGCAGAGAACTTTGACAAGTTCTTCACACGAGGACAGCCCGTCTTAACACCACCT
NM_002737.2       AAAGGAGCAGAGAACTTTGACAAGTTCTTCACACGAGGACAGCCCGTCTTAACACCACCT
                  ************************************************************

HsCD00000308      GATCAGCTGGTTATTGCTAACATAGACCAGTCTGATTTTGAAGGGTTCTCGTATGTCAAC
NM_002737.2       GATCAGCTGGTTATTGCTAACATAGACCAGTCTGATTTTGAAGGGTTCTCGTATGTCAAC
                  ************************************************************

HsCD00000308      CCCCAGTTTGTGCACCCCATCTTACAGAGTGCAGTATTG
NM_002737.2       CCCCAGTTTGTGCACCCCATCTTACAGAGTGCAGTATGA
                  ************************************* .

Pathways

NCI : ATF-2 transcription factor network
NCI : Canonical NF-kappaB pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PAR1-mediated thrombin signaling events
NCI : PDGFR-beta signaling pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Ras family activation
NCI : Retinoic acid receptors-mediated signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-4-mediated signaling events
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
NCI : VEGFR1 specific signals
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alpha adrenergic receptor signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : PDGF signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : VEGF signaling pathway
Panther : Wnt signaling pathway
Reactome : Acetylcholine regulates insulin secretion
Reactome : Ca-dependent events
Reactome : Ca2+ pathway
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Depolymerisation of the Nuclear Lamina
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Disinhibition of SNARE formation
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Extracellular matrix organization
Reactome : G alpha (z) signalling events
Reactome : G-protein mediated events
Reactome : GPCR downstream signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Gene Expression
Reactome : Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity
Reactome : Hemostasis
Reactome : HuR stabilizes mRNA
Reactome : Immune System
Reactome : Inactivation, recovery and regulation of the phototransduction cascade
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : M Phase
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Non-integrin membrane-ECM interactions
Reactome : Nuclear Envelope Breakdown
Reactome : Opioid Signalling
Reactome : PCP/CE pathway
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Regulation of insulin secretion
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : Syndecan interactions
Reactome : The phototransduction cascade
Reactome : Trafficking of AMPA receptors
Reactome : Trafficking of GluR2-containing AMPA receptors
Reactome : Transmission across Chemical Synapses
Reactome : Visual phototransduction
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : ErbB signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : Insulin Signaling
WikiPathway : Keap1-Nrf2 Pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : TOR signaling
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : angiogenesis overview
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 58126
HIP Master Clone ID : 38327
Original Clone ID : FLH058126.01L

Organism


TAX_ID : 9606
Species Specific ID: 5578

Genome

Chromosome : 17
Map Location : 17q22-q23.2
Ensembl : ENSG00000154229

Reagents

Labome : PKC-alpha-antibody