DNASU Plasmid Repository • 480.965.5697 | Email

AF1550 (Archaeoglobus fulgidus DSM 4304) in pMCSG19 (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AF1550
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: APC61425.2_SG137_pMCSG19
Keyword: partial cds
Species: Archaeoglobus fulgidus DSM 4304
Type: cDNA
Vector Name: pMCSG19               Format:  FUSION
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
Argonne National Laboratory
AfCD00310739

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 588nts         Open reading frame : 51 to 638

CTTCTGGCGTGGATCTGGGTACCGAGAACCTGTACTTCCAATCCAATGCCATGTTCGATT
TGCACGTCCACTCCGTTTTCAGCGACGGAGAACTGATCCCCTCAGAAATTGCAAGGAGGA
TGTACGCTGCGGGCAACAAAGGCTTTGCCATTACCGACCACGCGGACTTCACCAACATTC
AGGATATTCTGGCAAAGCTGACCAGAATAAAGGAGCACATGGAAAGCTACGAGGCCAAGT
TTCTTGTTGGCGTTGAAATCACTCACGTTCCTCCCAGTCTCATCGGCAAAGCCGTGGAGC
TTGCTTGGAAGGAAGGAGCGGAAATTGTTGTCGTTCATGGCGAAACCGTAGCCGAGCCGG
TAAAGGAGGGCACCAATCTCGCTGCACTGAGTGAGGAAATAACAATCTTGGCCCATCCGG
GCATAATGAGCGAAGAGGAGGCTGAGCTGGCCAGAGAAAACGGAATTTACGTTGAGATTT
CAGCCAGAAGGGGGCACTGCCTCGGCAACGGGAGAGTTGCGAGGCTTGCAGAGAAGTACG
GCTTTGAGCTTGTCATAAACACGGACATGCACTCCCCCTCGGACATAATCAATGACTCCA
CCGCTGAGAGGATTTTAAAGGGTGCCGGAGTAAAGGAGTAACATTGGAAGTGGATAACGG
ATCCGAATTCGAGCTCCGTCGACAAGCTT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in APC61425.2
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19

pMCSG19 in advanced viewed

Synonyms: pMCSG-19
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV, His, TEV, NA; amp resistance; ligation independent cloning (LIC).
Comments: pMCSG7 derivative: in vivo TVMV cleavage of MBP
Size (bp): 6441
Parent Vector: None
Empty Vector: EvNO00084265
Properties: bacterial expression, improves solubility of insert, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 16497515
Title: An expression vector tailored for large-scale, high-throughput purification of recombinant proteins

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC Ligation independent cloning (LIC) site 204 235
bacterial origin ori ColE1-type bacterial origin of replication 4416 5098
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV protease cleavage site 286 306
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI coding sequence 2045 3004
selectable marker AmpR ampicillin resistance gene 5193 6053
tag His 2 C-terminal 6xHis tag 140 157
tag His 6xHis tag 268 285
tag MBP N-terminal MBP 337 1443
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : AF1550
GENEID : 1484778
Locus Tag : AF1550
GI : 2649010
Target GenBank: None

 

Protein

SMART domain : POLIIIAc : DNA polymerase alpha chain like domain
Structural Annotation Wiki : TOPSAN
UniProt : O28722

Clone

Cloning Information : 490559
HIP Master Clone ID : 404239
Original Clone ID : APC61425.2_SG137_pMCSG19

Experimental

TargetTrack - Experimental data : APC61425.2

Organism


TAX_ID : 224325
Species Specific ID: 1484778

Reagents

Labome : AF1550-cDNA