DNASU Plasmid Repository • 480.965.5697 | Email

AF1233 (Archaeoglobus fulgidus) in pSGX2 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AF1233
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: 1029e2BNt1b1
Keyword: None
Species: Archaeoglobus fulgidus
Type: cDNA
Vector Name: pSGX2               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "N-terminal 6-His, TOPO"
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
AsCD00311919

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 639nts         Open reading frame : 51 to 689

TTTAAGAAGGAGATATACATATGGCTCATCATCACCATCACCACTCCCTTATTGACCTGC
ACATTCACTCAAACTACTCCGATGGACAGGGGAGCGTTGAGGAGATTGCGAGAAGGGCGA
AGGAGAGAGGGCTTAAGGCGATTGCAATAGTTGACCACTCCATCGAGCTGCCCTTCGGCC
TGACGGAAAAGAAGGCGAGAATGCGTGGAATAGAGATTGAGAACGCAGCATCGCTTTACG
GCATAAAGATTTACAGCGGAATTGAGTGCAGCATAAACGCAGTAGGAGAAATTGTCCTCC
CAGACTTTGACTTTGATTTCATCATCGCCTCAGTTCACGAGTTTGTATATGGACAGGCTT
ACTATGAGAGGGTAATCAGGTGCCTTGAAAGCCATGATGTTGATGTTCTCGGCCATCCCT
TCTCTCCACTCTTCGGTTTTGATGGCAGGCTTGCTGAGATGGACGAAAAGCTTCTGGATG
TTGTTGAGGAGAGGGGGGTGGAGGTAGAGCTAAACTCCTCCCACAAATCACCGCAGGATG
AGTTTTTGCAGCTCTGCAGAGACAGGAAAATTGCCTACAGTATTGGGAGCGATGCGCACA
GCCTTTCAGGTGTTGGTGAAGTGGGATGGAGTGTTGAGAAGGCTAAAAGATATATGGCGG
GAGCGAAACTCTTCACTCCAGAAGGGTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCG
GCCGCACTCGAGCACCACCA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
                                

5' Linker Sequence:
ATGGCTCATCATCACCATCACCACTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in NYSGXRC-1029e
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX2

pSGX2 in advanced viewed

Synonyms: pSGX-2, pSGX2_BN
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds N-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5328
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO TOPO cloning site 5097 5106
bacterial origin ColE ColE1 bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
repressor protein gene LacI LacI cds 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His N-terminal 6xHis tag 5078 5095
trxn regulatory element lac operator lac operator 5003 5025

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : AF1233
GENEID : 1484457
Locus Tag : AF1233
GI : 11498832
GenBank Accession : NP_070061.1
Target GenBank: None

 

Protein

SMART domain : POLIIIAc : DNA polymerase alpha chain like domain
Structural Annotation Wiki : TOPSAN
UniProt : O29035

Clone

Cloning Information : 501624
HIP Master Clone ID : 412791
Original Clone ID : 1029e2BNt1b1

Experimental

TargetTrack - Experimental data : NYSGXRC-1029e

Organism


TAX_ID : 224325
Species Specific ID: 1484457

Reagents

Labome : AF1233-cDNA