DNASU Plasmid Repository • 480.965.5697 | Email

FGF5 (Homo sapiens) in pSGX4 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FGF5
Gene Name:  fibroblast growth factor 5
Sequence             
Original Clone ID: 13019a5BSt9p1
Keyword: partial length cds 68-222 of 268 aa
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX4               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "N-terminal 6-His and Smt3, cleavable, TOPO"
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00312297

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/Smt3/SUMO

 

Insert sequence: 474nts         Open reading frame : 51 to 524
Reference Sequence Alignment

AGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTTGGCAGCCAAG
GAAGTGGCTTGGAGCAGAGCAGTTTCCAGTGGAGCCCCTCGGGGCGCCGGACCGGCAGCC
TCTACTGCAGAGTGGGCATCGGTTTCCATCTGCAGATCTACCCGGATGGCAAAGTCAATG
GATCCCACGAAGCCAATATGTTAAGTGTTTTGGAAATATTTGCTGTGTCTCAGGGGATTG
TAGGAATACGAGGAGTTTTCAGCAACAAATTTTTAGCGATGTCAAAAAAAGGAAAACTCC
ATGCAAGTGCCAAGTTCACAGATGACTGCAAGTTCAGGGAGCGTTTTCAAGAAAATAGCT
ATAATACCTATGCCTCAGCAATACATAGAACTGAAAAAACAGGGCGGGAGTGGTATGTGG
CCCTGAATAAAAGAGGAAAAGCCAAACGAGGGTGCAGCCCCCGGGTTAAACCCCAGCATA
TCTCTACCCATTTTCTGCCAAGATTCAAGCAGTCGGAAGGGTAACTCGAGCACCACCACC
ACCACCACTGAGATCCGGTGTAACAAGCCCAAAGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
AGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTC
AAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAA
AAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTA
GAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGAT
ATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in NYSGXRC-13019a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX4

pSGX4 in advanced viewed

Synonyms: pSGX-4, pSGX4_BS
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. TOPO adaptation at BamHI and XhoI sites.
Size (bp): 5611
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO TOPO cloning site 5435 5444
bacterial origin ColE ColE1 bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site (recognizes the tertiary structure of SUMO) 5140 5140
repressor protein gene LacI lacI cds 3515 4351
ribosome binding site RBS ribosome binding site (RBS) 5062 5068
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 Smt3 tag 5140 5424
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5539 5585

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FGF5
Symbol Nomenclature : FGF5
SYNONYM : HBGF-5; Smag-82
Designation : heparin-binding growth factor 5
Full Nomenclature : fibroblast growth factor 5
GENEID : 2250
GI : 73486655
GenBank Accession : NM_004464
HGNC : 3683
MIM : 165190
Vega : OTTHUMG00000130288
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00312297      ------------------------------------------------------------
NM_004464.3       ATGAGCTTGTCCTTCCTCCTCCTCCTCTTCTTCAGCCACCTGATCCTCAGCGCCTGGGCT
                                                                              

HsCD00312297      ------------------------------------------------------AGGATA
NM_004464.3       CACGGGGAGAAGCGTCTCGCCCCCAAAGGGCAACCCGGACCCGCTGCCACTGATAGGAAC
                                                                        ****:.

HsCD00312297      ACGATATTATTGAGGCTCACAGAGAACAGATTGG--------------------------
NM_004464.3       CCTAGAGGCTCCAGCAGCAGACAGAGCAGCAGTAGCGCTATGTCTTCCTCTTCTGCCTCC
                  .* * *  .*  ** . ** * ***.***.:  .                          

HsCD00312297      -----------TGGATCCCTTGGCAGCCAAGGAAGTGGCTTGGAGCAGAGCAGTTTCCAG
NM_004464.3       TCCTCCCCCGCAGCTTCTCTGGGCAGCCAAGGAAGTGGCTTGGAGCAGAGCAGTTTCCAG
                             :* :** ** ***************************************

HsCD00312297      TGGAGCCCCTCGGGGCGCCGGACCGGCAGCCTCTACTGCAGAGTGGGCATCGGTTTCCAT
NM_004464.3       TGGAGCCCCTCGGGGCGCCGGACCGGCAGCCTCTACTGCAGAGTGGGCATCGGTTTCCAT
                  ************************************************************

HsCD00312297      CTGCAGATCTACCCGGATGGCAAAGTCAATGGATCCCACGAAGCCAATATGTTAAGTGTT
NM_004464.3       CTGCAGATCTACCCGGATGGCAAAGTCAATGGATCCCACGAAGCCAATATGTTAAGTGTT
                  ************************************************************

HsCD00312297      TTGGAAATATTTGCTGTGTCTCAGGGGATTGTAGGAATACGAGGAGTTTTCAGCAACAAA
NM_004464.3       TTGGAAATATTTGCTGTGTCTCAGGGGATTGTAGGAATACGAGGAGTTTTCAGCAACAAA
                  ************************************************************

HsCD00312297      TTTTTAGCGATGTCAAAAAAAGGAAAACTCCATGCAAGTGCCAAGTTCACAGATGACTGC
NM_004464.3       TTTTTAGCGATGTCAAAAAAAGGAAAACTCCATGCAAGTGCCAAGTTCACAGATGACTGC
                  ************************************************************

HsCD00312297      AAGTTCAGGGAGCGTTTTCAAGAAAATAGCTATAATACCTATGCCTCAGCAATACATAGA
NM_004464.3       AAGTTCAGGGAGCGTTTTCAAGAAAATAGCTATAATACCTATGCCTCAGCAATACATAGA
                  ************************************************************

HsCD00312297      ACTGAAAAAACAGGGCGGGAGTGGTATGTGGCCCTGAATAAAAGAGGAAAAGCCAAACGA
NM_004464.3       ACTGAAAAAACAGGGCGGGAGTGGTATGTGGCCCTGAATAAAAGAGGAAAAGCCAAACGA
                  ************************************************************

HsCD00312297      GGGTGCAGCCCCCGGGTTAAACCCCAGCATATCTCTACCCATTTTCTGCCAAGATTCAAG
NM_004464.3       GGGTGCAGCCCCCGGGTTAAACCCCAGCATATCTCTACCCATTTTCTGCCAAGATTCAAG
                  ************************************************************

HsCD00312297      CAGTCG------------------------------------------------------
NM_004464.3       CAGTCGGAGCAGCCAGAACTTTCTTTCACGGTTACTGTTCCTGAAAAGAAAAAGCCACCT
                  ******                                                      

HsCD00312297      -------------GAAGGGTAACTCGAGCACCACCACCACCACCACTGAGATCCGGTGTA
NM_004464.3       AGCCCTATCAAGCCAAAGATTCCCCTTTCTGCACCTCGGAAAAATACCAACTCAGTGAAA
                                **.*.*:.* * : *: ****:* ...*..:.  *..**.*  .:*

HsCD00312297      ACAAGCCCAAAGA--------------
NM_004464.3       TACAGACTCAAGTTTCGCTTTGGATAA
                  :..**.* .***:              

Pathways

Panther : FGF signaling pathway
Reactome : Activated point mutants of FGFR2
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FGFR ligand binding and activation
Reactome : FGFR1 ligand binding and activation
Reactome : FGFR1c ligand binding and activation
Reactome : FGFR2 ligand binding and activation
Reactome : FGFR2c ligand binding and activation
Reactome : FGFR3 ligand binding and activation
Reactome : FGFR3c ligand binding and activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by FGFR2 mutants
Reactome : Signaling by FGFR3 mutants
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by activated point mutants of FGFR1
Reactome : Signaling by activated point mutants of FGFR3
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Regulation of Actin Cytoskeleton

Protein

SMART domain : FGF : Acidic and basic fibroblast growth factor family.
Structural Annotation Wiki : TOPSAN
UniProt : Q8NBG6
UniProt : P12034
UniProt : Q8NF90
HPRD : 01307

Clone

Cloning Information : 507520
HIP Master Clone ID : 418687
Original Clone ID : 13019a5BSt9p1

Experimental

TargetTrack - Experimental data : NYSGXRC-13019a

Organism


TAX_ID : 9606
Species Specific ID: 2250

Genome

Chromosome : 4
Map Location : 4q21
Ensembl : ENSG00000138675

Reagents

Labome : FGF5-antibody
Labome : FGF5-protein