DNASU Plasmid Repository • 480.965.5697 | Email

DVU0655 (D. vulgaris str. Hildenborough ) in pSGX4

TOP

Explanation of Terms


Gene: Gene Symbol:  DVU0655
Gene Name:  phosphotransferase domain-containing protein
Sequence             
Original Clone ID: 9634a3BSt4p1
Keyword: full-length cds 2-286 of 288 aa
Species: Desulfovibrio vulgaris str. Hildenborough
Type: cDNA
Vector Name: pSGX4               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "N-terminal 6-His and Smt3, cleavable, TOPO"
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
DvCD00312600

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/Smt3/SUMO

 

Insert sequence: 858nts         Open reading frame : 51 to 908

AGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTTACGCCCCGCT
TCATCGACCTTCACACCCATACCACGGCATCCGACGGTAGCGACAGCCCGGCCGACCTCG
TCCGCAAGGCCACAGAGGCGGGTCTTGCCGCCGTCGCCGTCACCGACCACGACACCGTGG
CGGGTCTCGACGAGGCCGTAGCCATGGGCCACGAGACGGGCATCGAGGTCGTGCGAGGCT
GCGAACTCGGCGTGCGCAGCGAATATGGCGAGATACACATCCTCGGCCTCTGGCTGCCCG
AAAAACCCGAGACACTTCTCGACGCCATGAAGGAACTGCGCAGACACCGCAACGAACGCA
ACGAGCGTATCGTGGACAATCTGCGCACGCTCGGCATGGACATCACCTACGAAGAGGTGC
GTGCCCTTTCCGGTGGCGTCTCGGTGGGGCGCCCGCACATCGCCCTCGCCCTGCTCAGGC
ATGGCTACATCCGCACTCCGCAAGAGGCCTTCGACCGATTCATCGGCCCCGGTGCCCCGG
CCTACGCGCCCAAGAAGGTCTTCTCACCAGCCGAAGGCGTGCGACTGCTCGCCTCATGCG
GCGCAACGGTGGCCATCGCCCACCCCATGCTCTTGCGCTGCCCGGAAGAATGGCTCGACG
ACACCGTGGCCGACCTCAAGGTCGCGGGGCTTGACGCCATCGAAGCCTACCACAGCGAGC
ATTCCCACAAGGACGAGCGCCGTTGCGTGGACATCGCCGACCGGCACGGGCTGGTGCTCA
CCGGCGGTTCGGACTACCACGGCAAGGCCAAGCCCGCCATTTCGCTAGGCCGGGGACGCG
GCGGACTGCGCGTGACCACCCATGTGCTCGACAACCTCAAGCGCCACCGGCGCGAACGCG
GCCTGTAAGGGTAACTCGAGCACCACCACCACCACCACGAGATCCGGCTCTAACAAGCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
AGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTC
AAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAA
AAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTA
GAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGAT
ATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in NYSGXRC-9634a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX4

pSGX4 in advanced viewed

Synonyms: pSGX-4, pSGX4_BS
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. TOPO adaptation at BamHI and XhoI sites.
Size (bp): 5611
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO TOPO cloning site 5435 5444
bacterial origin ColE ColE1 bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site (recognizes the tertiary structure of SUMO) 5140 5140
repressor protein gene LacI lacI cds 3515 4351
ribosome binding site RBS ribosome binding site (RBS) 5062 5068
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 Smt3 tag 5140 5424
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5539 5585

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : DVU0655
GENEID : 2794241
Locus Tag : DVU0655
GI : 46448482
Target GenBank: None

 

Protein

SMART domain : POLIIIAc : DNA polymerase alpha chain like domain
Structural Annotation Wiki : TOPSAN
UniProt : Q72EC3

Clone

Cloning Information : 508084
HIP Master Clone ID : 419251
Original Clone ID : 9634a3BSt4p1

Experimental

TargetTrack - Experimental data : NYSGXRC-9634a

Organism


TAX_ID : 882
Species Specific ID: 2794241

Reagents

Labome : DVU0655-cDNA