DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  MLP28
Gene Name:  MLP-like protein 28
Sequence              Map: pDONR cofig.pdf
Original Clone ID: 1341.1.94_GO.74365
Keyword: partial cds
Species: Arabidopsis thaliana Columbia
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: Parent TargetDB: GO.33961; This is a GATEWAY entry clone having a TEV protease cleavage site fused to the open reading frame with the initiation codon replaced with TCC.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
AtCD00313176

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 495nts         Open reading frame : 51 to 545

ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
ACTTCCAGTCCACGGAGGCGTCTAGTTTGGTGGGGAAGCTAGAGACAGACGTGGAGATCA
AGGCTTCGGCTGATAAGTTTCACCACATGTTCGCTGGGAAACCACACCATGTCTCCAAAG
CAAGTCCAGGCAACATTCAGGGATGTGATCTGCACGAAGGCGACTGGGGCACAGTCGGCT
CTATCGTCTTCTGGAATTACGTACATGATGGGGAGGCAAAGGTGGCGAAGGAGAGGATCG
AGGCGGTGGAGCCAGATAAGAACTTGATCACGTTTAGGGTTATAGAAGGTGATCTGATGA
AAGAGTACAAGAGCTTCTTGCTCACCATCCAGGTGACCCCTAAGCCTGGAGGCCCTGGAA
GTATTGTGCACTGGCACCTTGAGTATGAGAAAATTAGCGAGGAGGTAGCTCACCCGGAAA
CTCTCCTCCAGTTCTGTGTCGAGGTCTCCAAAGAGATCGACGAACATCTTTTGGCCGAGG
AATAGTAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
CCAACTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTTGGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in GO.74365
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MLP28
SYNONYM : F15H11.8; F15H11_8; MLP-like protein 28
GENEID : 843420
Locus Tag : AT1G70830
TAIR : AT1G70830
Target GenBank: BT014717

 

Protein

PDB - Structural Annotation : 2I9Y
SMART domain : Bet_v_1 : Pathogenesis-related protein Bet v I family
Structural Annotation Wiki : TOPSAN
UniProt : Q9SSK9
UniProt : A8MR61
UniProt : B3H4F3
UniProt : A8MRH3
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 512418
HIP Master Clone ID : 423585
Original Clone ID : 1341.1.94_GO.74365

Experimental

Structural Biology Knowledgebase : SBKB (2I9Y)
TargetTrack - Experimental data : GO.74365

Organism


TAX_ID : 3702
Species Specific ID: 843420

Genome

Chromosome : 1

Reagents

Labome : MLP28-cDNA