DNASU Plasmid Repository • 480.965.5697 | Email

Fam20c (Mus musculus) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Fam20c
Gene Name:  family with sequence similarity 20, member C
Sequence              Map: pDONR cofig.pdf
Original Clone ID: 1234.1.50_GO.36090
Keyword: full-length cds
Species: Mus musculus
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: This is a GATEWAY entry clone having a TEV protease cleavage site fused to the open reading frame with the initiation codon replaced with TCC.
Mutation/
Discrepancy :
No / No
Publications: PMID: 22582013
Title: Secreted kinase phosphorylates extracellular proteins that regulate biomineralization
PMID: 22582013
Title: Secreted kinase phosphorylates extracellular proteins that regulate biomineralization
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
MmCD00313240

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 777nts         Open reading frame : 51 to 827

ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
ACTTCCAGTCCATCAACATGACCAAGGAGATCCGGGATGTGACGCGGGATAAGAAGCTAT
GGAGAACTTTCTTTGTGTCTCCAGCCAACAACATCTGTTTCTACGGGGAGTGTTCCTACT
ACTGTTCCACCGAGCATGCCCTGTGTGGGAGGCCCGACCAGATCGAAGGATCCCTGGCGG
CCTTCCTGCCTGACCTGTCGCTGGCCAAGAGGAAGACATGGCGGAACCCCTGGCGTCGTT
CCTACCACAAGCGAAAGAAGGCAGAGTGGGAAGTCGACCCTGATTACTGTGAGGAGGTGA
AGCAGACGCCACCCTACGACAGTGGCCACCGAATCCTGGACATCATGGATATGACCGTCT
TTGATTTCCTCATGGGGAACATGGATCGGCATCACTACGAGACCTTTGAGAAGTTCGGGA
ATGAGACCTTCATCATCCACTTGGACAACGGGCGCGGGTTTGGGAAATACTCACACGATG
AGCTTTCCATTCTCGCTCCTCTTCATCAGTGCTGCAGGATCAGGAGGTCCACCTACCTGA
GACTGCAGCTGCTGGCCAAAGAGGAACACAAACTGAGCCTGCTGATGGCCGAGTCCCTGC
AGCATGACAAGGTGGCACCCGTGCTCTACCAGCTGCATCTGGAGGCCCTGGACCGGCGGT
TGCGCATAGTGCTGCAGGCTGTGCGAGACTGTGTGGAGAAGGACGGGCTGAGCAGTGTGG
TGGAGGACGACCTAGCCACTGAGCACAGAGCCTCCACGGAGAGGTAGTAGGACCCAGCTT
TCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
CCAACTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTTGGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in GO.36090
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : Fam20c
Symbol Nomenclature : Fam20c
SYNONYM : C76981; DMP-4; DMP4; GEF-CK; mKIAA4081
Designation : dentin matrix protein 4|extracellular serine/threonine protein kinase FAM20C|golgi-enriched fraction casein kinase
Full Nomenclature : family with sequence similarity 20, member C
GENEID : 80752
GI : 167234439
GenBank Accession : NM_030565
Mouse Genome Informatics : 2136853
Vega : OTTMUSG00000030351
Target GenBank: NM_030565

 

Protein

Structural Annotation Wiki : TOPSAN
UniProt : Q5MJS3

Clone

Cloning Information : 512927
HIP Master Clone ID : 424094
Original Clone ID : 1234.1.50_GO.36090

Experimental

TargetTrack - Experimental data : GO.36090

Organism


TAX_ID : 10090
Species Specific ID: 80752

Genome

Chromosome : 5
Map Location : 5 G2|5
Ensembl : ENSMUSG00000025854

Reagents

Labome : Fam20c-antibody