DNASU Plasmid Repository • 480.965.5697 | Email

ALKBH2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ALKBH2
Gene Name:  alkB, alkylation repair homolog 2 (E. coli)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: 1234.1.69_GO.56708
Keyword: nan
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: This is a GATEWAY entry clone having a TEV protease cleavage site fused to the open reading frame with the initiation codon replaced with TCC.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
HsCD00313285

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 834nts        
Open reading frame : 1 to 834

ATGCCAACTTTGTACAAAAAAGCAGGCTCCGAAAACCTGTACTTCCAGTCCGACAGATTC
CTGGTGAAAGGGGCTCAAGGGGGCCTTTTGAGGAAGCAGGAGGAGCAAGAGCCAACTGGA
GAAGAGCCAGCTGTGTTGGGAGGAGACAAAGAAAGCACAAGGAAGAGGCCCAGGAGAGAG
GCCCCAGGGAATGGAGGCCACTCAGCAGGCCCTAGCTGGCGGCACATTCGGGCTGAGGGC
CTGGACTGCAGTTACACAGTCCTGTTTGGCAAAGCTGAGGCAGATGAGATTTTCCAAGAG
TTGGAGAAAGAAGTAGAATATTTTACAGGAGCACTGGCCAGAGTCCAGGTATTCGGGAAG
TGGCACAGTGTGCCCAGGAAGCAGGCAACGTATGGCGACGCTGGGCTGACCTACACATTT
TCAGGCCTCACGCTGTCTCCAAAGCCCTGGATCCCAGTTCTAGAGCGCATCCGGGATCAC
GTCTCTGGGGTGACTGGACAGACCTTCAACTTTGTGCTCATCAACAGGTATAAAGATGGC
TGTGACCACATCGGGGAGCACCGAGATGATGAAAGAGAACTGGCCCCTGGGAGCCCCATT
GCCTCTGTCTCCTTCGGTGCCTGCAGAGACTTTGTCTTCCGGCATAAGGATTCCCGTGGG
AAAAGCCCCTCCAGGAGGGTGGCGGTGGTCAGGCTGCCGCTGGCCCACGGGAGCTTACTA
ATGATGAACCACCCGACCAACACGCACTGGTACCACAGTCTTCCCGTGAGAAAGAAGGTT
CTGGCTCCACGGGTGAATCTGACTTTTCGTAAAATTTTGCTTACTAAAAAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
CCAACTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTTGGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in GO.56708
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ALKBH2
Symbol Nomenclature : ALKBH2
SYNONYM : ABH2
Designation : 2OG-Fe(II) oxy DC1|DNA oxidative demethylase ALKBH2|alkylated DNA repair protein alkB homolog 2|alpha-ketoglutarate-dependent dioxygenase alkB homolog 2|oxy DC1
Full Nomenclature : alkB, alkylation repair homolog 2 (E. coli)
GENEID : 121642
GI : 48717226
GenBank Accession : NM_001001655
HGNC : 32487
MIM : 610602
Vega : OTTHUMG00000169246
Target GenBank: NM_001001655

 

Pathways

Reactome : ABH2 mediated Reversal of Alkylation Damage
Reactome : DNA Damage Reversal
Reactome : DNA Repair
Reactome : Reversal of Alkylation Damage By DNA Dioxygenases

Protein

Structural Annotation Wiki : TOPSAN
UniProt : A4PET2
UniProt : Q6NS38
HPRD : 14712

Clone

Cloning Information : 512984
HIP Master Clone ID : 424151
Original Clone ID : 1234.1.69_GO.56708

Experimental

TargetTrack - Experimental data : GO.56708

Organism


TAX_ID : 9606
Species Specific ID: 121642

Genome

Chromosome : 12
Map Location : 12q24.11
Ensembl : ENSG00000189046

Reagents

Labome : ALKBH2-antibody