DNASU Plasmid Repository • 480.965.5697 | Email

ATP5G1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATP5G1
Gene Name:  ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110887.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003189

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 411nts         Open reading frame : 1 to 411
Reference Sequence Alignment

ATGCAGACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGT
CTAATCAGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCT
TCCTACAGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCC
CGGGACATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCT
GGTTCAGGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAAC
CCTTCTCTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCC
ATGGGGCTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 449
Start on reference sequence 39
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATP5G1
Symbol Nomenclature : ATP5G1
SYNONYM : ATP5A; ATP5G
Designation : ATP synthase F(0) complex subunit C1, mitochondrial|ATP synthase lipid-binding protein, mitochondrial|ATP synthase proteolipid P1|ATP synthase proton-transporting mitochondrial F(0) complex subunit C1|ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9)|ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9)|ATPase protein 9|ATPase subunit 9|ATPase subunit C|mitochondrial ATP synthase, subunit 9|mitochondrial ATP synthase, subunit C
Full Nomenclature : ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
GENEID : 516
GI : 61372841
GenBank Accession : AY891995
HGNC : 841
MIM : 603192
Vega : OTTHUMG00000160520
Target GenBank: BC004963

 

Reference Sequence Alignment

  

HsCD00003189        ATGCAGACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGT
NM_001002027.1      ATGCAGACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGT
NM_005175.2         ATGCAGACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGT
                    ************************************************************

HsCD00003189        CTAATCAGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCT
NM_001002027.1      CTAATCAGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCT
NM_005175.2         CTAATCAGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCT
                    ************************************************************

HsCD00003189        TCCTACAGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCC
NM_001002027.1      TCCTACAGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCC
NM_005175.2         TCCTACAGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCC
                    ************************************************************

HsCD00003189        CGGGACATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCT
NM_001002027.1      CGGGACATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCT
NM_005175.2         CGGGACATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCT
                    ************************************************************

HsCD00003189        GGTTCAGGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAAC
NM_001002027.1      GGTTCAGGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAAC
NM_005175.2         GGTTCAGGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAAC
                    ************************************************************

HsCD00003189        CCTTCTCTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCC
NM_001002027.1      CCGTCTCTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCC
NM_005175.2         CCGTCTCTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCC
                    ** *********************************************************

HsCD00003189        ATGGGGCTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTTG
NM_001002027.1      ATGGGGCTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGA
NM_005175.2         ATGGGGCTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGA
                    ************************************************* .

Pathways

Reactome : Formation of ATP by chemiosmotic coupling
Reactome : Metabolism
Reactome : Metabolism of proteins
Reactome : Mitochondrial protein import
Reactome : Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins.
Reactome : The citric acid (TCA) cycle and respiratory electron transport
WikiPathway : Electron Transport Chain
WikiPathway : Oxidative phosphorylation

Protein

UniProt : Q6FIH7
UniProt : P05496
HPRD : 04428

Clone

Cloning Information : 110887
HIP Master Clone ID : 87170
Original Clone ID : FLH110887.01L

Organism


TAX_ID : 9606
Species Specific ID: 516

Genome

Chromosome : 17
Map Location : 17q21.32
Ensembl : ENSG00000159199

Reagents

Labome : ATP5G1-antibody