DNASU Plasmid Repository • 480.965.5697 | Email

HDAC1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HDAC1
Gene Name:  histone deacetylase 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130972.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000320

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1449nts         Open reading frame : 1 to 1449
Reference Sequence Alignment

ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGA
AATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCATAAT
TTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAAT
GCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGT
CCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGT
CCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGT
GCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCAC
CATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATC
CTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCATGGT
GACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCATAAG
TATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGCAAG
TATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCCATT
TTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTACAG
TGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAAGGA
CACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGAGGC
GGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCCCTG
GATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCAGAT
TTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAG
AAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTCCAA
ATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGAC
CCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAGTTC
TCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAAGCC
AAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTCACC
GAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTCAAG
TTGGCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1512
Start on reference sequence 64
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HDAC1
Symbol Nomenclature : HDAC1
SYNONYM : GON-10; HD1; RPD3; RPD3L1
Designation : reduced potassium dependency, yeast homolog-like 1
Full Nomenclature : histone deacetylase 1
GENEID : 3065
Locus Tag : RP4-811H24.2
GI : 60814458
GenBank Accession : AY893265
HGNC : 4852
MIM : 601241
Vega : OTTHUMG00000007529
Target GenBank: NM_004964

 

Reference Sequence Alignment

  

HsCD00000320      ---ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTT
NM_001527.3       ATGGCGTACAGTCAAGGAGGCGGCAAAAAAAAAGTCTGCTACTACTACGACGGTGATATT
NM_004964.2       ---ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTT
                     . * . .. ... ..***. *...*..******** ************** ***.**

HsCD00000320      GGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCAT
NM_001527.3       GGAAATTATTATTATGGACAGGGTCATCCCATGAAGCCTCATAGAATCCGCATGACCCAT
NM_004964.2       GGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCAT
                  ******** ***********.** ** **.*********** .************* ***

HsCD00000320      AATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCC
NM_001527.3       AACTTGCTGTTAAATTATGGCTTATACAGAAAAATGGAAATATATAGGCCCCATAAAGCC
NM_004964.2       AATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCC
                  ** ****** *.** *****  *.***.*************.***.* ** ** ******

HsCD00000320      AATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATC
NM_001527.3       ACTGCCGAAGAAATGACAAAATATCACAGTGATGAGTATATCAAATTTCTACGGTCAATA
NM_004964.2       AATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATC
                  *.*** **.**.*****.**.** ***** ***** ** ** *****  *.** **.**.

HsCD00000320      CGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGAC
NM_001527.3       AGACCAGATAACATGTCTGAGTATAGTAAGCAGATGCAGAGATTTAATGTTGGAGAAGAT
NM_004964.2       CGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGAC
                  .*:************** ***** ** ***************** ** *****:**.** 

HsCD00000320      TGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCA
NM_001527.3       TGTCCAGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCAACTGGCGGTTCAGTTGCT
NM_004964.2       TGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCA
                  ********.** *****.** ******** ****** * **:***** *****:** **:

HsCD00000320      AGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTG
NM_001527.3       GGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTA
NM_004964.2       AGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTG
                  .*:********. *:** ...**.***** ** ** ***** ***********.**. *.

HsCD00000320      CACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCC
NM_001527.3       CATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCC
NM_004964.2       CACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCC
                  ** *****:*****.**.**.*****:**.*********** ******** **  * ***

HsCD00000320      ATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCAT
NM_001527.3       ATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCAT
NM_004964.2       ATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCAT
                  ***** *** *.*********** *****.**  *.** ***** **:******** ***

HsCD00000320      GGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCAT
NM_001527.3       GGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCAT
NM_004964.2       GGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCAT
                  ***** ** ** *****.** ** ** **.**.** ** **.***** **.**.** ***

HsCD00000320      AAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGC
NM_001527.3       AAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGC
NM_004964.2       AAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGC
                  **.*****.**.***** **:**.**:**.*** *..******* ** *****.******

HsCD00000320      AAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCC
NM_001527.3       AAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAG
NM_004964.2       AAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCC
                  **.** ******** ** *: **..* .**** ** **:***** *****.****.* . 

HsCD00000320      ATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTA
NM_001527.3       ATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTA
NM_004964.2       ATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTA
                  **:** ***** .* ** **.**.**.**********: **.******** *****.***

HsCD00000320      CAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAA
NM_001527.3       CAGTGTGGTGCAGACTCATTATCTGGTGATAGACTGGGTTGTTTCAATCTAACAGTCAAA
NM_004964.2       CAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAA
                  ********  *******. ******* ***.*. *.***** ***********:.*****

HsCD00000320      GGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGA
NM_001527.3       GGTCATGCTAAATGTGTAGAAGTTGTAAAAACTTTTAACTTACCATTACTGATGCTTGGA
NM_004964.2       GGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGA
                  **:** ** **.*****.*** ****.**.*  ****** *.**::*.******** ***

HsCD00000320      GGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
NM_001527.3       GGAGGTGGCTACACAATCCGTAATGTTGCTCGATGTTGGACATATGAGACTGCAGTTGCC
NM_004964.2       GGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
                  **.***** *****.** ***** ***** **.** **************:**:** ***

HsCD00000320      CTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCA
NM_001527.3       CTTGATTGTGAGATTCCCAATGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCA
NM_004964.2       CTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCA
                  ** ***:  ***** ** ****** * ***** ***** ********.** *********

HsCD00000320      GATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTG
NM_001527.3       GACTTCAAACTGCATATTAGTCCTTCAAACATGACAAACCAGAACACTCCAGAATATATG
NM_004964.2       GATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTG
                  ** *****.** ** ** ********.** *****:*********** ..:**.** .**

HsCD00000320      GAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTC
NM_001527.3       GAAAAGATAAAACAGCGTTTGTTTGAAAATTTGCGCATGTTACCTCATGCACCTGGTGTC
NM_004964.2       GAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTC
                  **.*****.********: *******.**  * .*.*** *.** ** ******** ***

HsCD00000320      CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGAC
NM_001527.3       CAGATGCAAGCTATTCCAGAAGATGCTGTTCATGAAGACAGTGGAGATGAAGATGGAGAA
NM_004964.2       CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGAC
                  **.*****.** *****:**.** ** .* *.***.** *****.*****.** *.***.

HsCD00000320      GACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAG
NM_001527.3       GATCCAGACAAGAGAATTTCTATTCGAGCATCAGACAAGCGGATAGCTTGTGATGAAGAA
NM_004964.2       GACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAG
                  ** **:******.*.** ** **  *. *.**:*****.**.**:** ***** *****.

HsCD00000320      TTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAA
NM_001527.3       TTCTCAGATTCTGAGGATGAAGGAGAAGGAGGTCGAAGAAATGTGGCTGATCATAAGAAA
NM_004964.2       TTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAA
                  *****.********.** **.*****.**.** **.*..**     * .*  : **.***

HsCD00000320      GCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTC
NM_001527.3       GGAGCAAAGAAAGCTAGAATTGAAGAAGATAAGAAAGAAACAGAGGACAAAAAAACAGAC
NM_004964.2       GCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTC
                  * ....*...:...:* *.: **:***.*:.*******..******* **.***..**:*

HsCD00000320      ACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTC
NM_001527.3       GTTAAGGAAGAAGATAAATCCAAGGACAACAGTGGTGAAAAAACAGATACCAAAGGAACC
NM_004964.2       ACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTC
                  .  .*.**.**..*:*..:. .**** ** . :*.:*..***. .*: *. .*.*... *

HsCD00000320      AAGTTGGCCTGA---------------
NM_001527.3       AAATCAGAACAGCTCAGCAACCCCTGA
NM_004964.2       AAGTTGGCCTGA---------------
                  **.* .*.. ..               

Pathways

NCI : E2F transcription factor network
NCI : Glucocorticoid receptor regulatory network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IL3-mediated signaling events
NCI : Notch signaling pathway
NCI : Notch-mediated HES/HEY network
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of Androgen receptor activity
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of retinoblastoma protein
NCI : Retinoic acid receptors-mediated signaling
NCI : Signaling events mediated by HDAC Class I
NCI : Sumoylation by RanBP2 regulates transcriptional repression
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
Panther : Wnt signaling pathway
Panther : p53 pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Disease
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Epigenetic regulation of gene expression
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G0 and Early G1
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Hemostasis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Mitotic G1-G1/S phases
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : TCF dependent signaling in response to WNT
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcription
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : formation of the beta-catenin:TCF transactivating complex
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR negatively regulates cell cycle via SC1
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : Energy Metabolism
WikiPathway : IL-6 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TWEAK Signaling Pathway

Protein

UniProt : Q13547
UniProt : Q6IT96
HPRD : 03143

Clone

Cloning Information : 130972
HIP Master Clone ID : 107129
Original Clone ID : FLH130972.01X

Organism


TAX_ID : 9606
Species Specific ID: 3065

Genome

Chromosome : 1
Map Location : 1p34
Ensembl : ENSG00000116478

Reagents

Labome : HDAC1-antibody