DNASU Plasmid Repository • 480.965.5697 | Email

DUSP4 (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DUSP4
Gene Name:  dual specificity phosphatase 4
Sequence             
Original Clone ID: 8689a7BCt5p1
Keyword: partial length cds 104-246 of 303 aa
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "C-terminal 6-His, TOPO"
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00321862

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 456nts         Open reading frame : 51 to 506

CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCTTGGTCCTGTGG
AGATCCTTCCCTTCCTCTACCTCGGCAGTGCCTACCATGCTGCCCGGAGAGACATGCTGG
ACGCCCTGGGCATCACGGCTCTGTTGAATGTCTCCTCGGACTGCCCAAACCACTTTGAAG
GACACTATCAGTACAAGTGCATCCCAGTGGAAGATAACCACAAGGCCGACATCAGCTCCT
GGTTCATGGAAGCCATAGAGTACATCGATGCCGTGAAGGACTGCCGTGGGCGCGTGCTGG
TGCACTGCCAGGCGGGCATCTCGCGGTCGGCCACCATCTGCCTGGCCTACCTGATGATGA
AGAAACGGGTGAGGCTGGAGGAGGCCTTCGAGTTCGTTAAGCAGCGCCGCAGCATCATCT
CGCCCAACTTCAGCTTCATGGGGCAGCTGCTGCAGTTCGAGTCCCAGGTGCTGGCCACGG
AAGGGCATCATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCC
GCACTCGAGCACCACCA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8689a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DUSP4
Symbol Nomenclature : DUSP4
SYNONYM : HVH2; MKP-2; MKP2; TYP
Designation : MAP kinase phosphatase 2|VH1 homologous phosphatase 2|dual specificity protein phosphatase 4|dual specificity protein phosphatase hVH2|mitogen-activated protein kinase phosphatase 2|serine/threonine specific protein phosphatase
Full Nomenclature : dual specificity phosphatase 4
GENEID : 1846
GI : 16950652
GenBank Accession : NM_057158
HGNC : 3070
MIM : 602747
Vega : OTTHUMG00000133395
Target GenBank: None

 

Pathways

Reactome : Activated TLR4 signalling
Reactome : ERK/MAPK targets
Reactome : ERKs are inactivated
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : MAPK signaling pathway

Clone

Cloning Information : 516104
HIP Master Clone ID : 426424
Original Clone ID : 8689a7BCt5p1

Experimental

TargetTrack - Experimental data : NYSGXRC-8689a

Organism


TAX_ID : 9606
Species Specific ID: 1846

Genome

Chromosome : 8
Map Location : 8p12-p11
Ensembl : ENSG00000120875

Reagents

Labome : DUSP4-antibody