DNASU Plasmid Repository • 480.965.5697 | Email

BAD (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BAD
Gene Name:  BCL2-associated agonist of cell death
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110490.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003220

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 507nts         Open reading frame : 1 to 507
Reference Sequence Alignment

ATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGG
GGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAG
GCCCCAGGCCTCCTGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCAT
CATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACG
GAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCG
CCCCCCAACCTCTGGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAG
TTTGTGGACTCCTTTAAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAG
ATGCGGCAAAGCTCCAGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGC
AGGGGAAGCTCCGCCCCCTCCCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 528
Start on reference sequence 22
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BAD
Symbol Nomenclature : BAD
SYNONYM : BBC2; BCL2L8
Designation : BCL-X/BCL-2 binding protein|BCL2-antagonist of cell death protein|BCL2-binding component 6|BCL2-binding protein|bcl-2-binding component 6|bcl-2-like protein 8|bcl-XL/Bcl-2-associated death promoter|bcl2 antagonist of cell death|bcl2-L-8
Full Nomenclature : BCL2-associated agonist of cell death
GENEID : 572
GI : 61372923
GenBank Accession : AY892012
HGNC : 936
MIM : 603167
Vega : OTTHUMG00000134302
Target GenBank: BC001901

 

Reference Sequence Alignment

  

HsCD00003220      ATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGG
NM_032989.2       ATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGG
NM_004322.3       ATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGG
                  ************************************************************

HsCD00003220      GGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAG
NM_032989.2       GGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAG
NM_004322.3       GGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAG
                  ************************************************************

HsCD00003220      GCCCCAGGCCTCCTGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCAT
NM_032989.2       GCCCCAGGCCTCCTGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCAT
NM_004322.3       GCCCCAGGCCTCCTGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCAT
                  ************************************************************

HsCD00003220      CATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACG
NM_032989.2       CATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACG
NM_004322.3       CATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACG
                  ************************************************************

HsCD00003220      GAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCG
NM_032989.2       GAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCG
NM_004322.3       GAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCG
                  ************************************************************

HsCD00003220      CCCCCCAACCTCTGGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAG
NM_032989.2       CCCCCCAACCTCTGGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAG
NM_004322.3       CCCCCCAACCTCTGGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAG
                  ************************************************************

HsCD00003220      TTTGTGGACTCCTTTAAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAG
NM_032989.2       TTTGTGGACTCCTTTAAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAG
NM_004322.3       TTTGTGGACTCCTTTAAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAG
                  ************************************************************

HsCD00003220      ATGCGGCAAAGCTCCAGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGC
NM_032989.2       ATGCGGCAAAGCTCCAGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGC
NM_004322.3       ATGCGGCAAAGCTCCAGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGC
                  ************************************************************

HsCD00003220      AGGGGAAGCTCCGCCCCCTCCCAGTTG
NM_032989.2       AGGGGAAGCTCCGCCCCCTCCCAGTGA
NM_004322.3       AGGGGAAGCTCCGCCCCCTCCCAGTGA
                  ************************* .

Pathways

NCI : Alpha-synuclein signaling
NCI : CXCR4-mediated signaling events
NCI : Ceramide signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : IGF1 pathway
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : p75(NTR)-mediated signaling
Reactome : AKT phosphorylates targets in the cytosol
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : BH3-only proteins associate with and inactivate anti-apoptotic BCL-2 members
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Intrinsic Pathway for Apoptosis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NRAGE signals death through JNK
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : angiogenesis overview

Protein

UniProt : Q92934
UniProt : Q6FH21
HPRD : 04409

Clone

Cloning Information : 110490
HIP Master Clone ID : 86620
Original Clone ID : FLH110490.01L

Organism


TAX_ID : 9606
Species Specific ID: 572

Genome

Chromosome : 11
Map Location : 11q13.1
Ensembl : ENSG00000002330

Reagents

Labome : BAD-antibody