DNASU Plasmid Repository • 480.965.5697 | Email

ZBP1 (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ZBP1
Gene Name:  Z-DNA binding protein 1
Sequence             
Original Clone ID: 13081a1BCt5p1
Keyword: partial length cds 6-172 of 429 aa
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "C-terminal 6-His, TOPO"
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00322083

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 528nts         Open reading frame : 51 to 578

CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCTTGCTGACCCGG
GCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGG
TGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCC
TCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTCACATCCCCTGCCACCTGGTGCTTGG
GCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAGCTGGCCTTGTCCAGCCCTGCCGAGA
GGCCCCAGCAACATGCAGCTACAATTCCAGAGACCCCTGGCCCTCAGTTCAGCCAACAAC
GGGAGGAAGACATCTACAGGTTTCTCAAAGACAATGGTCCCCAGAGGGCCCTGGTCATCG
CCCAAGCACTGGGAATGAGGACAGCAAAAGATGTGAACCGAGACTTGTACAGGATGAAGA
GCAGGCACCTTCTGGACATGGATGAGCAGTCCAAAGCATGGACGATTTACCGCCCAGAAG
ATTCTGGAAGAGAAGGGCATCATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGAC
AAGCTTGCGGCCGCACTCGAGCACCACCA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-13081a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ZBP1
Symbol Nomenclature : ZBP1
SYNONYM : C20orf183; DAI; DLM-1; DLM1
Designation : DNA-dependent activator of IFN-regulatory factors|DNA-dependent activator of IRFs|DNA-dependent activator of interferon regulatory factors|Z-DNA-binding protein 1|tumor stroma and activated macrophage protein DLM-1
Full Nomenclature : Z-DNA binding protein 1
GENEID : 81030
Locus Tag : RP4-718J7.1
GI : 238550206
GenBank Accession : NM_030776
HGNC : 16176
MIM : 606750
Vega : OTTHUMG00000032824
Target GenBank: None

 

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : ZBP1(DAI) mediated induction of type I IFNs

Protein

SMART domain : Zalpha : Z-DNA-binding domain in adenosine deaminases.
Structural Annotation Wiki : TOPSAN
UniProt : B3KVA1
UniProt : A2A2F7
UniProt : Q9H171
HPRD : 09484

Clone

Cloning Information : 516568
HIP Master Clone ID : 426888
Original Clone ID : 13081a1BCt5p1

Experimental

TargetTrack - Experimental data : NYSGXRC-13081a

Organism


TAX_ID : 9606
Species Specific ID: 81030

Genome

Chromosome : 20
Map Location : 20q13.31
Ensembl : ENSG00000124256

Reagents

Labome : DLM-1-antibody