Gene: |
Gene Symbol:
None Gene Name:  None Sequence |
---|---|
Original Clone ID: | 72284 |
Keyword: | SP or TM removed |
Species: | Bacteroides uniformis ATCC 8492 |
Type: | cDNA |
Vector Name: | pSpeedET Format: FUSION |
Source: | Joint Center for Structural Genomics |
Description: | None |
Comments: | None |
Mutation/ Discrepancy : |
No / No |
Publications: | None |
Authors: |
PSI Joint Center for Structural Genomics |
BuCD00323338 Price: Login for Pricing AVAILABLE No restriction Special MTA: PSI |
Insert sequence: 330nts
Open reading frame : 51 to 380CTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGCGATGAGGATG
ATAAGGTCGAAATTCCTCAACTGGTAGGTAAGTGGATTGTGAAAGAACCAGTCCTGCAGG
ACGATTTTGTGACCTGCTATACGTTTAATGCAGACAAGACCTATGAAGTTTATACCGGAA
GCCCGTTATCTAACGGAGTCCCTTTTCGTGGAACTTATATCATAAGTCTTGATGAAAAAT
TGATTAAGTTGTATGATAAAGAGGAACATTGTACTGAACAATATCATATTTTGAAACTGA
CGTCCAAGGAGATGAAGTGGGAGAACGCATCGCCCAAAGACGGGAATTCTGACAAACGGC
TTGAGAAGTACAACGATTAACGCGACTTAATTAA
|
Coding Sequence Details | |
---|---|
Insert Sequence Verified?: Y | Verification Method: Sequence Verification |
Mutations: None |
Discrepancy: None |
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGC |
|
3' Linker Sequence:
TAACGCGACTTAATTAA |
Distributed in bacterial strain : | DH5-alpha T1 phage resistant |
---|---|
Antibiotic Selection: |
Host Type:
bacterial
Marker:
kanamycin Bacterial Selection Condition: 50ug/mL kanamycin Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended. Comments: Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors. |
Protein Expression Results: |
ProteinExpressed: Not_Applicable ProteinPurified: Not_Applicable SolubleProtein: Not_Applicable Find experimental protocols in 417984 |
Recommended expression in: | HK100 |
  Powered by LabGenius |
||
Vector Name: | pSpeedET |
pSpeedET in advanced viewed |
Synonyms: | pSpeed-ET | |
Sequencing Primer: | Forward:
pBAD forward
Reverse: alt_bad_rev |
|
Description: | Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHHENLYFQG tag; kanamycin resistance; PIPE cloning. | |
Comments: | If this vector contains an insert, the ccdB death cassette will not be present. | |
Size (bp): | 5464 | |
Parent Vector: | None | |
Empty Vector: | EvNO00285791 | |
Properties: | PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker | |
Author Name: |
Joint Center for Structural Genomics |
|
Publications: |
PMID:
18004753
Title: Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts. |
|
Vector Map: |
![]() ![]() |
|
Sequence: |
Vector Features:
Type | Name | Description | Start Position | End Position |
---|---|---|---|---|
bacterial origin | ori | ColE1-type origin of replication | 3306 | 3988 |
inducible trxn activator protein gene | araC | araC coding sequence | 4563 | 5438 |
negative selection marker | ccdB | ccdB death cassette gene (lost in with-insert form) | 1596 | 1805 |
promoter | araC | araC promoter | 256 | 285 |
promoter | T7 | T7 promoter | 290 | 310 |
protease cleavage site | TEV | TEV protease cleavage site | 382 | 402 |
selectable marker | CmR | chloramphenicol resistance gene (CmR) (lost in with-insert form) | 502 | 1158 |
selectable marker | KanR | kanamycin resistance gene | 2396 | 3208 |
tag | His | N-terminal 6xHis tag | 364 | 381 |
trxn regulatory element | arabinose O2 operator | arabinose O2 operator | 5 | 23 |
trxn regulatory element | arabinose O1 operator | arabinose O1 operator | 161 | 182 |
trxn termination sequence | rrnB | rrnB T2 transcription terminator | 2258 | 2284 |