DNASU Plasmid Repository • 480.965.5697 | Email

CFLAR (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CFLAR
Gene Name:  CASP8 and FADD-like apoptosis regulator
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110413.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003244

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1443nts         Open reading frame : 1 to 1443
Reference Sequence Alignment

ATGTCTGCTGAAGTCATCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATG
CTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTT
CTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTAC
AGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAG
ACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATT
GGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATG
GGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAA
CTAAATCTGGTTGCCCCAGATCAACTGGATTTATTAGAAAAATGCCTAAAGAACATCCAC
AGAATAGACCTGAAGACAAAAATCCAGAAGTACAAGCAGTCTGTTCAAGGAGCAGGGACA
AGTTACAGGAATGTTCTCCAAGCAGCAATCCAAAAGAGTCTCAAGGATCCTTCAAATAAC
TTCAGGCTCCATAATGGGAGAAGTAAAGAACAAAGACTTAAGGAACAGCTTGGCGCTCAA
CAAGAACCAGTGAAGAAATCCATTCAGGAATCAGAAGCTTTTTTGCCTCAGAGCATACCT
GAAGAGAGATACAAGATGAAGAGCAAGCCCCTAGGAATCTGCCTGATAATCGATTGCATT
GGCAATGAGACAGAGCTTCTTCGAGACACCTTCACTTCCCTGGGCTATGAAGTCCAGAAA
TTCTTGCATCTCAGTATGCATGGTATATCCCAGATTCTTGGCCAATTTGCCTGTATGCCC
GAGCACCGAGACTACGACAGCTTTGTGTGTGTCCTGGTGAGCCGAGGAGGCTCCCAGAGT
GTGTATGGTGTGGATCAGACTCACTCAGGGCTCCCCCTGCATCACATCAGGAGGATGTTC
ATGGGAGATTCATGCCCTTATCTAGCAGGGAAGCCAAAGATGTTTTTTATTCAGAACTAT
GTGGTGTCAGAGGGCCAGCTGGAGGACAGCAGCCTCTTGGAGGTGGATGGGCCAGCGATG
AAGAATGTGGAATTCAAGGCTCAGAAGCGAGGGCTGTGCACAGTTCACCGAGAAGCTGAC
TTCTTCTGGAGCCTGTGTACTGCGGACATGTCCCTGCTGGAGCAGTCTCACAGCTCACCA
TCCCTGTACCTGCAGTGCCTCTCCCAGAAACTGAGACAAGAAAGAAAACGCCCACTCCTG
GATCTTCACATTGAACTCAATGGCTACATGTATGATTGGAACAGCAGAGTTTCTGCCAAG
GAGAAATATTATGTCTGGCTGCAGCACACTCTGAGAAAGAAACTTATCCTCTCCTACACA
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1702
Start on reference sequence 260
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CFLAR
Symbol Nomenclature : CFLAR
SYNONYM : CASH; CASP8AP1; CLARP; Casper; FLAME; FLAME-1; FLAME1; FLIP; I-FLICE; MRIT; c-FLIP; c-FLIPL; c-FLIPR; c-FLIPS
Designation : FADD-like anti-apoptotic molecule|FADD-like antiapoptotic molecule 1|MACH-related inducer of toxicity|caspase homolog|caspase-eight-related protein|caspase-like apoptosis regulatory protein|caspase-related inducer of apoptosis|cellular FLICE-like inhibitory protein|inhibitor of FLICE|usurpin beta
Full Nomenclature : CASP8 and FADD-like apoptosis regulator
GENEID : 8837
GI : 60655574
GenBank Accession : AY889560
HGNC : 1876
MIM : 603599
Vega : OTTHUMG00000132819
Target GenBank: BC001602

 

Reference Sequence Alignment

  

HsCD00003244        ATGTCTGCTGAAGTCATCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATG
NM_003879.5         ATGTCTGCTGAAGTCATCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATG
NM_001202516.1      ATGTCTGCTGAAGTCATCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATG
NM_001127183.2      ATGTCTGCTGAAGTCATCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATG
                    ************************************************************

HsCD00003244        CTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTT
NM_003879.5         CTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTT
NM_001202516.1      CTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTT
NM_001127183.2      CTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTT
                    ************************************************************

HsCD00003244        CTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTAC
NM_003879.5         CTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTAC
NM_001202516.1      CTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTAC
NM_001127183.2      CTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTAC
                    ************************************************************

HsCD00003244        AGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAG
NM_003879.5         AGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAG
NM_001202516.1      AGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAG
NM_001127183.2      AGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAG
                    ************************************************************

HsCD00003244        ACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATT
NM_003879.5         ACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATT
NM_001202516.1      ACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATT
NM_001127183.2      ACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATT
                    ************************************************************

HsCD00003244        GGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATG
NM_003879.5         GGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATG
NM_001202516.1      GGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATG
NM_001127183.2      GGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATG
                    ************************************************************

HsCD00003244        GGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAA
NM_003879.5         GGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAA
NM_001202516.1      GGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAA
NM_001127183.2      GGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAA
                    ************************************************************

HsCD00003244        CTAAATCTGGTTGCCCCAGATCAACTGGATTTATTAGAAAAATGCCTAAAGAACATCCAC
NM_003879.5         CTAAATCTGGTTGCCCCAGATCAACTGGATTTATTAGAAAAATGCCTAAAGAACATCCAC
NM_001202516.1      CTAAATCTGGTTGCCCCAGATCAACTGGATTTATTAGAAAAATGCCTAAAGAACATCCAC
NM_001127183.2      CTAAATCTGGTTGCCCCAGATCAACTGGATTTATTAGAAAAATGCCTAAAGAACATCCAC
                    ************************************************************

HsCD00003244        AGAATAGACCTGAAGACAAAAATCCAGAAGTACAAGCAGTCTGTTCAAGGAGCAGGGACA
NM_003879.5         AGAATAGACCTGAAGACAAAAATCCAGAAGTACAAGCAGTCTGTTCAAGGAGCAGGGACA
NM_001202516.1      AGAATAGACCTGAAGACAAAAATCCAGAAGTACAAGCAGTCTGTTCAAGGAGCAGGGACA
NM_001127183.2      AGAATAGACCTGAAGACAAAAATCCAGAAGTACAAGCAGTCTGTTCAAGGAGCAGGGACA
                    ************************************************************

HsCD00003244        AGTTACAGGAATGTTCTCCAAGCAGCAATCCAAAAGAGTCTCAAGGATCCTTCAAATAAC
NM_003879.5         AGTTACAGGAATGTTCTCCAAGCAGCAATCCAAAAGAGTCTCAAGGATCCTTCAAATAAC
NM_001202516.1      AGTTACAGGAATGTTCTCCAAGCAGCAATCCAAAAGAGTCTCAAGGATCCTTCAAATAAC
NM_001127183.2      AGTTACAGGAATGTTCTCCAAGCAGCAATCCAAAAGAGTCTCAAGGATCCTTCAAATAAC
                    ************************************************************

HsCD00003244        TTCAGGCTCCATAATGGGAGAAGTAAAGAACAAAGACTTAAGGAACAGCTTGGCGCTCAA
NM_003879.5         TTCAGGCTCCATAATGGGAGAAGTAAAGAACAAAGACTTAAGGAACAGCTTGGCGCTCAA
NM_001202516.1      TTCAG-------------------------------------------------------
NM_001127183.2      TTCAGGCTCCATAATGGGAGAAGTAAAGAACAAAGACTTAAGGAACAGCTTGGCGCTCAA
                    *****                                                       

HsCD00003244        CAAGAACCAGTGAAGAAATCCATTCAGGAATCAGAAGCTTTTTTGCCTCAGAGCATACCT
NM_003879.5         CAAGAACCAGTGAAGAAATCCATTCAGGAATCAGAAGCTTTTTTGCCTCAGAGCATACCT
NM_001202516.1      --------------------------------------------------GAGCATACCT
NM_001127183.2      CAAGAACCAGTGAAGAAATCCATTCAGGAATCAGAAGCTTTTTTGCCTCAGAGCATACCT
                                                                      **********

HsCD00003244        GAAGAGAGATACAAGATGAAGAGCAAGCCCCTAGGAATCTGCCTGATAATCGATTGCATT
NM_003879.5         GAAGAGAGATACAAGATGAAGAGCAAGCCCCTAGGAATCTGCCTGATAATCGATTGCATT
NM_001202516.1      GAAGAGAGATACAAGATGAAGAGCAAGCCCCTAGGAATCTGCCTGATAATCGATTGCATT
NM_001127183.2      GAAGAGAGATACAAGATGAAGAGCAAGCCCCTAGGAATCTGCCTGATAATCGATTGCATT
                    ************************************************************

HsCD00003244        GGCAATGAGACAGAGCTTCTTCGAGACACCTTCACTTCCCTGGGCTATGAAGTCCAGAAA
NM_003879.5         GGCAATGAGACAGAGCTTCTTCGAGACACCTTCACTTCCCTGGGCTATGAAGTCCAGAAA
NM_001202516.1      GGCAATGAGACAGAGCTTCTTCGAGACACCTTCACTTCCCTGGGCTATGAAGTCCAGAAA
NM_001127183.2      GGCAATGAGACAGAGCTTCTTCGAGACACCTTCACTTCCCTGGGCTATGAAGTCCAGAAA
                    ************************************************************

HsCD00003244        TTCTTGCATCTCAGTATGCATGGTATATCCCAGATTCTTGGCCAATTTGCCTGTATGCCC
NM_003879.5         TTCTTGCATCTCAGTATGCATGGTATATCCCAGATTCTTGGCCAATTTGCCTGTATGCCC
NM_001202516.1      TTCTTGCATCTCAGTATGCATGGTATATCCCAGATTCTTGGCCAATTTGCCTGTATGCCC
NM_001127183.2      TTCTTGCATCTCAGTATGCATGGTATATCCCAGATTCTTGGCCAATTTGCCTGTATGCCC
                    ************************************************************

HsCD00003244        GAGCACCGAGACTACGACAGCTTTGTGTGTGTCCTGGTGAGCCGAGGAGGCTCCCAGAGT
NM_003879.5         GAGCACCGAGACTACGACAGCTTTGTGTGTGTCCTGGTGAGCCGAGGAGGCTCCCAGAGT
NM_001202516.1      GAGCACCGAGACTACGACAGCTTTGTGTGTGTCCTGGTGAGCCGAGGAGGCTCCCAGAGT
NM_001127183.2      GAGCACCGAGACTACGACAGCTTTGTGTGTGTCCTGGTGAGCCGAGGAGGCTCCCAGAGT
                    ************************************************************

HsCD00003244        GTGTATGGTGTGGATCAGACTCACTCAGGGCTCCCCCTGCATCACATCAGGAGGATGTTC
NM_003879.5         GTGTATGGTGTGGATCAGACTCACTCAGGGCTCCCCCTGCATCACATCAGGAGGATGTTC
NM_001202516.1      GTGTATGGTGTGGATCAGACTCACTCAGGGCTCCCCCTGCATCACATCAGGAGGATGTTC
NM_001127183.2      GTGTATGGTGTGGATCAGACTCACTCAGGGCTCCCCCTGCATCACATCAGGAGGATGTTC
                    ************************************************************

HsCD00003244        ATGGGAGATTCATGCCCTTATCTAGCAGGGAAGCCAAAGATGTTTTTTATTCAGAACTAT
NM_003879.5         ATGGGAGATTCATGCCCTTATCTAGCAGGGAAGCCAAAGATGTTTTTTATTCAGAACTAT
NM_001202516.1      ATGGGAGATTCATGCCCTTATCTAGCAGGGAAGCCAAAGATGTTTTTTATTCAGAACTAT
NM_001127183.2      ATGGGAGATTCATGCCCTTATCTAGCAGGGAAGCCAAAGATGTTTTTTATTCAGAACTAT
                    ************************************************************

HsCD00003244        GTGGTGTCAGAGGGCCAGCTGGAGGACAGCAGCCTCTTGGAGGTGGATGGGCCAGCGATG
NM_003879.5         GTGGTGTCAGAGGGCCAGCTGGAGGACAGCAGCCTCTTGGAGGTGGATGGGCCAGCGATG
NM_001202516.1      GTGGTGTCAGAGGGCCAGCTGGAGGACAGCAGCCTCTTGGAGGTGGATGGGCCAGCGATG
NM_001127183.2      GTGGTGTCAGAGGGCCAGCTGGAGGACAGCAGCCTCTTGGAGGTGGATGGGCCAGCGATG
                    ************************************************************

HsCD00003244        AAGAATGTGGAATTCAAGGCTCAGAAGCGAGGGCTGTGCACAGTTCACCGAGAAGCTGAC
NM_003879.5         AAGAATGTGGAATTCAAGGCTCAGAAGCGAGGGCTGTGCACAGTTCACCGAGAAGCTGAC
NM_001202516.1      AAGAATGTGGAATTCAAGGCTCAGAAGCGAGGGCTGTGCACAGTTCACCGAGAAGCTGAC
NM_001127183.2      AAGAATGTGGAATTCAAGGCTCAGAAGCGAGGGCTGTGCACAGTTCACCGAGAAGCTGAC
                    ************************************************************

HsCD00003244        TTCTTCTGGAGCCTGTGTACTGCGGACATGTCCCTGCTGGAGCAGTCTCACAGCTCACCA
NM_003879.5         TTCTTCTGGAGCCTGTGTACTGCGGACATGTCCCTGCTGGAGCAGTCTCACAGCTCACCA
NM_001202516.1      TTCTTCTGGAGCCTGTGTACTGCGGACATGTCCCTGCTGGAGCAGTCTCACAGCTCACCA
NM_001127183.2      TTCTTCTGGAGCCTGTGTACTGCGGACATGTCCCTGCTGGAGCAGTCTCACAGCTCACCA
                    ************************************************************

HsCD00003244        TCCCTGTACCTGCAGTGCCTCTCCCAGAAACTGAGACAAGAAAGAAAACGCCCACTCCTG
NM_003879.5         TCCCTGTACCTGCAGTGCCTCTCCCAGAAACTGAGACAAGAAAGAAAACGCCCACTCCTG
NM_001202516.1      TCCCTGTACCTGCAGTGCCTCTCCCAGAAACTGAGACAAGAAAGAAAACGCCCACTCCTG
NM_001127183.2      TCCCTGTACCTGCAGTGCCTCTCCCAGAAACTGAGACAAGAAAGAAAACGCCCACTCCTG
                    ************************************************************

HsCD00003244        GATCTTCACATTGAACTCAATGGCTACATGTATGATTGGAACAGCAGAGTTTCTGCCAAG
NM_003879.5         GATCTTCACATTGAACTCAATGGCTACATGTATGATTGGAACAGCAGAGTTTCTGCCAAG
NM_001202516.1      GATCTTCACATTGAACTCAATGGCTACATGTATGATTGGAACAGCAGAGTTTCTGCCAAG
NM_001127183.2      GATCTTCACATTGAACTCAATGGCTACATGTATGATTGGAACAGCAGAGTTTCTGCCAAG
                    ************************************************************

HsCD00003244        GAGAAATATTATGTCTGGCTGCAGCACACTCTGAGAAAGAAACTTATCCTCTCCTACACA
NM_003879.5         GAGAAATATTATGTCTGGCTGCAGCACACTCTGAGAAAGAAACTTATCCTCTCCTACACA
NM_001202516.1      GAGAAATATTATGTCTGGCTGCAGCACACTCTGAGAAAGAAACTTATCCTCTCCTACACA
NM_001127183.2      GAGAAATATTATGTCTGGCTGCAGCACACTCTGAGAAAGAAACTTATCCTCTCCTACACA
                    ************************************************************

HsCD00003244        TAG
NM_003879.5         TAA
NM_001202516.1      TAA
NM_001127183.2      TAA
                    **.

Pathways

NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : TRAIL signaling pathway
NCI : Validated targets of C-MYC transcriptional repression
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : Regulation by c-FLIP
Reactome : TRAIL signaling
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : TNF alpha Signaling Pathway

Protein

SMART domain : CASc : Caspase, interleukin-1 beta converting enzyme (ICE) homologues
SMART domain : DED : Death effector domain
UniProt : O15519
UniProt : B4DJE0
UniProt : B4E361
HPRD : 04671

Clone

Cloning Information : 110413
HIP Master Clone ID : 86703
Original Clone ID : FLH110413.01X

Organism


TAX_ID : 9606
Species Specific ID: 8837

Genome

Chromosome : 2
Map Location : 2q33-q34
Ensembl : ENSG00000003402

Reagents

Labome : FLIP-antibody