DNASU Plasmid Repository • 480.965.5697 | Email

PRKCI (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKCI
Gene Name:  protein kinase C, iota
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000138.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000325

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1764nts         Open reading frame : 1 to 1764
Reference Sequence Alignment

ATGTCCCACACGGTCGCAGGCGGCGGCAGCGGGGACCATTCCCACCAGGTCCGGGTGAAA
GCCTACTACCGCGGGGATATCATGATAACACATTTTGAACCTTCCATCTCCTTTGAGGGC
CTTTGCAATGAGGTTCGAGACATGTGTTCTTTTGACAACGAACAGCTCTTCACCATGAAA
TGGATAGATGAGGAAGGAGACCCGTGTACAGTATCATCTCAGTTGGAGTTAGAAGAAGCC
TTTAGACTTTATGAGCTAAACAAGGATTCTGAACTCTTGATTCATGTGTTCCCTTGTGTA
CCAGAACGTCCTGGGATGCCTTGTCCAGGAGAAGATAAATCCATCTACCGTAGAGGTGCA
CGCCGCTGGAGAAAGCTTTATTGTGCCAATGGCCACACTTTCCAAGCCAAGCGTTTCAAC
AGGCGTGCTCACTGTGCCATCTGCACAGACCGAATATGGGGACTTGGACGCCAAGGATAT
AAGTGCATCAACTGCAAACTCTTGGTTCATAAGAAGTGCCATAAACTCGTCACAATTGAA
TGTGGGCGGCATTCTTTGCCACAGGAACCAGTGATGCCCATGGATCAGTCATCCATGCAT
TCTGACCATGCACAGACAGTAATTCCATATAATCCTTCAAGTCATGAGAGTTTGGATCAA
GTTGGTGAAGAAAAAGAGGCAATGAACACCAGGGAAAGTGGCAAAGCTTCATCCAGTCTA
GGTCTTCAGGATTTTGATTTGCTCCGGGTAATAGGAAGAGGAAGTTATGCCAAAGTACTG
TTGGTTCGATTAAAAAAAACAGATCGTATTTATGCAATGAAAGTTGTGAAAAAAGAGCTT
GTTAATGATGATGAGGATATTGATTGGGTACAGACAGAGAAGCATGTGTTTGAGCAGGCA
TCCAATCATCCTTTCCTTGTTGGGCTGCATTCTTGCTTTCAGACAGAAAGCAGATTGTTC
TTTGTTATAGAGTATGTAAATGGAGGAGACCTAATGTTTCATATGCAGCGACAAAGAAAA
CTTCCTGAAGAACATGCCAGATTTTACTCTGCAGAAATCAGTCTAGCATTAAATTATCTT
CATGAGCGAGGGATAATTTATAGAGATTTGAAACTGGACAATGTATTACTGGACTCTGAA
GGCCACATTAAACTCACTGACTACGGCATGTGTAAGGAAGGATTACGGCCAGGAGATACA
ACCAGCACTTTCTGTGGTACTCCTAATTACATTGCTCCTGAAATTTTAAGAGGAGAAGAT
TATGGTTTCAGTGTTGACTGGTGGGCTCTTGGAGTGCTCATGTTTGAGATGATGGCAGGA
AGGTCTCCATTTGATATTGTTGGGAGCTCCGATAACCCTGACCAGAACACAGAGGATTAT
CTCTTCCAAGTTATTTTGGAAAAACAAATTCGCATACCACGTTCTCTGTCTGTAAAAGCT
GCGAGTGTTCTGAAGAGTTTTCTTAATAAGGACCCTAAGGAACGATTGGGTTGTCATCCT
CAAACAGGATTTGCTGATATTCAGGGACACCCGTTCTTCCGAAATGTTGATTGGGATATG
ATGGAGCAAAAACAGGTGGTACCTCCCTTTAAACCAAATATTTCTGGGGAATTTGGTTTG
GACAACTTTGATTCTCAGTTTACTAATGAACCTGTCCAGCTCACTCCAGATGACGATGAC
ATTGTGAGGAAGATTGATCAGTCTGAATTTGAAGGTTTTGAGTATATCAATCCTCTTTTG
ATGTCTGCAGAAGAATGTGTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1968
Start on reference sequence 205
Mutations:
None
Discrepancy:
a1443g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKCI
Symbol Nomenclature : PRKCI
SYNONYM : DXS1179E; PKCI; nPKC-iota
Designation : PRKC-lambda/iota|aPKC-lambda/iota|atypical protein kinase C-lambda/iota|protein kinase C iota type
Full Nomenclature : protein kinase C, iota
GENEID : 5584
GI : 33304196
GenBank Accession : AY335779
HGNC : 9404
MIM : 600539
Vega : OTTHUMG00000150214
Target GenBank: NM_002740

 

Reference Sequence Alignment

  

HsCD00000325      ---------------------------ATGTCCCACACGGTCGCAGGCGGCGGCAGCGGG
NM_002740.5       ATGCCGACCCAGAGGGACAGCAGCACCATGTCCCACACGGTCGCAGGCGGCGGCAGCGGG
                                             *********************************

HsCD00000325      GACCATTCCCACCAGGTCCGGGTGAAAGCCTACTACCGCGGGGATATCATGATAACACAT
NM_002740.5       GACCATTCCCACCAGGTCCGGGTGAAAGCCTACTACCGCGGGGATATCATGATAACACAT
                  ************************************************************

HsCD00000325      TTTGAACCTTCCATCTCCTTTGAGGGCCTTTGCAATGAGGTTCGAGACATGTGTTCTTTT
NM_002740.5       TTTGAACCTTCCATCTCCTTTGAGGGCCTTTGCAATGAGGTTCGAGACATGTGTTCTTTT
                  ************************************************************

HsCD00000325      GACAACGAACAGCTCTTCACCATGAAATGGATAGATGAGGAAGGAGACCCGTGTACAGTA
NM_002740.5       GACAACGAACAGCTCTTCACCATGAAATGGATAGATGAGGAAGGAGACCCGTGTACAGTA
                  ************************************************************

HsCD00000325      TCATCTCAGTTGGAGTTAGAAGAAGCCTTTAGACTTTATGAGCTAAACAAGGATTCTGAA
NM_002740.5       TCATCTCAGTTGGAGTTAGAAGAAGCCTTTAGACTTTATGAGCTAAACAAGGATTCTGAA
                  ************************************************************

HsCD00000325      CTCTTGATTCATGTGTTCCCTTGTGTACCAGAACGTCCTGGGATGCCTTGTCCAGGAGAA
NM_002740.5       CTCTTGATTCATGTGTTCCCTTGTGTACCAGAACGTCCTGGGATGCCTTGTCCAGGAGAA
                  ************************************************************

HsCD00000325      GATAAATCCATCTACCGTAGAGGTGCACGCCGCTGGAGAAAGCTTTATTGTGCCAATGGC
NM_002740.5       GATAAATCCATCTACCGTAGAGGTGCACGCCGCTGGAGAAAGCTTTATTGTGCCAATGGC
                  ************************************************************

HsCD00000325      CACACTTTCCAAGCCAAGCGTTTCAACAGGCGTGCTCACTGTGCCATCTGCACAGACCGA
NM_002740.5       CACACTTTCCAAGCCAAGCGTTTCAACAGGCGTGCTCACTGTGCCATCTGCACAGACCGA
                  ************************************************************

HsCD00000325      ATATGGGGACTTGGACGCCAAGGATATAAGTGCATCAACTGCAAACTCTTGGTTCATAAG
NM_002740.5       ATATGGGGACTTGGACGCCAAGGATATAAGTGCATCAACTGCAAACTCTTGGTTCATAAG
                  ************************************************************

HsCD00000325      AAGTGCCATAAACTCGTCACAATTGAATGTGGGCGGCATTCTTTGCCACAGGAACCAGTG
NM_002740.5       AAGTGCCATAAACTCGTCACAATTGAATGTGGGCGGCATTCTTTGCCACAGGAACCAGTG
                  ************************************************************

HsCD00000325      ATGCCCATGGATCAGTCATCCATGCATTCTGACCATGCACAGACAGTAATTCCATATAAT
NM_002740.5       ATGCCCATGGATCAGTCATCCATGCATTCTGACCATGCACAGACAGTAATTCCATATAAT
                  ************************************************************

HsCD00000325      CCTTCAAGTCATGAGAGTTTGGATCAAGTTGGTGAAGAAAAAGAGGCAATGAACACCAGG
NM_002740.5       CCTTCAAGTCATGAGAGTTTGGATCAAGTTGGTGAAGAAAAAGAGGCAATGAACACCAGG
                  ************************************************************

HsCD00000325      GAAAGTGGCAAAGCTTCATCCAGTCTAGGTCTTCAGGATTTTGATTTGCTCCGGGTAATA
NM_002740.5       GAAAGTGGCAAAGCTTCATCCAGTCTAGGTCTTCAGGATTTTGATTTGCTCCGGGTAATA
                  ************************************************************

HsCD00000325      GGAAGAGGAAGTTATGCCAAAGTACTGTTGGTTCGATTAAAAAAAACAGATCGTATTTAT
NM_002740.5       GGAAGAGGAAGTTATGCCAAAGTACTGTTGGTTCGATTAAAAAAAACAGATCGTATTTAT
                  ************************************************************

HsCD00000325      GCAATGAAAGTTGTGAAAAAAGAGCTTGTTAATGATGATGAGGATATTGATTGGGTACAG
NM_002740.5       GCAATGAAAGTTGTGAAAAAAGAGCTTGTTAATGATGATGAGGATATTGATTGGGTACAG
                  ************************************************************

HsCD00000325      ACAGAGAAGCATGTGTTTGAGCAGGCATCCAATCATCCTTTCCTTGTTGGGCTGCATTCT
NM_002740.5       ACAGAGAAGCATGTGTTTGAGCAGGCATCCAATCATCCTTTCCTTGTTGGGCTGCATTCT
                  ************************************************************

HsCD00000325      TGCTTTCAGACAGAAAGCAGATTGTTCTTTGTTATAGAGTATGTAAATGGAGGAGACCTA
NM_002740.5       TGCTTTCAGACAGAAAGCAGATTGTTCTTTGTTATAGAGTATGTAAATGGAGGAGACCTA
                  ************************************************************

HsCD00000325      ATGTTTCATATGCAGCGACAAAGAAAACTTCCTGAAGAACATGCCAGATTTTACTCTGCA
NM_002740.5       ATGTTTCATATGCAGCGACAAAGAAAACTTCCTGAAGAACATGCCAGATTTTACTCTGCA
                  ************************************************************

HsCD00000325      GAAATCAGTCTAGCATTAAATTATCTTCATGAGCGAGGGATAATTTATAGAGATTTGAAA
NM_002740.5       GAAATCAGTCTAGCATTAAATTATCTTCATGAGCGAGGGATAATTTATAGAGATTTGAAA
                  ************************************************************

HsCD00000325      CTGGACAATGTATTACTGGACTCTGAAGGCCACATTAAACTCACTGACTACGGCATGTGT
NM_002740.5       CTGGACAATGTATTACTGGACTCTGAAGGCCACATTAAACTCACTGACTACGGCATGTGT
                  ************************************************************

HsCD00000325      AAGGAAGGATTACGGCCAGGAGATACAACCAGCACTTTCTGTGGTACTCCTAATTACATT
NM_002740.5       AAGGAAGGATTACGGCCAGGAGATACAACCAGCACTTTCTGTGGTACTCCTAATTACATT
                  ************************************************************

HsCD00000325      GCTCCTGAAATTTTAAGAGGAGAAGATTATGGTTTCAGTGTTGACTGGTGGGCTCTTGGA
NM_002740.5       GCTCCTGAAATTTTAAGAGGAGAAGATTATGGTTTCAGTGTTGACTGGTGGGCTCTTGGA
                  ************************************************************

HsCD00000325      GTGCTCATGTTTGAGATGATGGCAGGAAGGTCTCCATTTGATATTGTTGGGAGCTCCGAT
NM_002740.5       GTGCTCATGTTTGAGATGATGGCAGGAAGGTCTCCATTTGATATTGTTGGGAGCTCCGAT
                  ************************************************************

HsCD00000325      AACCCTGACCAGAACACAGAGGATTATCTCTTCCAAGTTATTTTGGAAAAACAAATTCGC
NM_002740.5       AACCCTGACCAGAACACAGAGGATTATCTCTTCCAAGTTATTTTGGAAAAACAAATTCGC
                  ************************************************************

HsCD00000325      ATACCACGTTCTCTGTCTGTAAAAGCTGCGAGTGTTCTGAAGAGTTTTCTTAATAAGGAC
NM_002740.5       ATACCACGTTCTCTGTCTGTAAAAGCTGCAAGTGTTCTGAAGAGTTTTCTTAATAAGGAC
                  *****************************.******************************

HsCD00000325      CCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCG
NM_002740.5       CCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCG
                  ************************************************************

HsCD00000325      TTCTTCCGAAATGTTGATTGGGATATGATGGAGCAAAAACAGGTGGTACCTCCCTTTAAA
NM_002740.5       TTCTTCCGAAATGTTGATTGGGATATGATGGAGCAAAAACAGGTGGTACCTCCCTTTAAA
                  ************************************************************

HsCD00000325      CCAAATATTTCTGGGGAATTTGGTTTGGACAACTTTGATTCTCAGTTTACTAATGAACCT
NM_002740.5       CCAAATATTTCTGGGGAATTTGGTTTGGACAACTTTGATTCTCAGTTTACTAATGAACCT
                  ************************************************************

HsCD00000325      GTCCAGCTCACTCCAGATGACGATGACATTGTGAGGAAGATTGATCAGTCTGAATTTGAA
NM_002740.5       GTCCAGCTCACTCCAGATGACGATGACATTGTGAGGAAGATTGATCAGTCTGAATTTGAA
                  ************************************************************

HsCD00000325      GGTTTTGAGTATATCAATCCTCTTTTGATGTCTGCAGAAGAATGTGTCTTG
NM_002740.5       GGTTTTGAGTATATCAATCCTCTTTTGATGTCTGCAGAAGAATGTGTCTGA
                  ************************************************* .

Pathways

NCI : IL1-mediated signaling events
NCI : Insulin Pathway
NCI : Insulin-mediated glucose transport
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : TNF receptor signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : VEGF signaling pathway
Panther : Wnt signaling pathway
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Cell-cell junction organization
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Tight junction interactions
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : G Protein Signaling Pathways
WikiPathway : Insulin Signaling
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 138
HIP Master Clone ID : 87197
Original Clone ID : FLH000138.01L

Organism


TAX_ID : 9606
Species Specific ID: 5584

Genome

Chromosome : 3
Map Location : 3q26.3
Ensembl : ENSG00000163558

Reagents

Labome : PRKCI-antibody