DNASU Plasmid Repository • 480.965.5697 | Email

BAK1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BAK1
Gene Name:  BCL2-antagonist/killer 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117380.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003287

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 636nts        
Open reading frame : 1 to 636
Reference Sequence Alignment

ATGGCTTCGGGGCAAGGCCCAGGTCCTCCCAGGCAGGAGTGCGGAGAGCCTGCCCTGCCC
TCTGCTTCTGAGGAGCAGGTAGCCCAGGACACAGAGGAGGTTTTCCGCAGCTACGTTTTT
TACCGCCATCAGCAGGAACAGGAGGCTGAAGGGGTGGCTGCCCCTGCCGACCCAGAGATG
GTCACCTTACCTCTGCAACCTAGCAGCACCATGGGGCAGGTGGGACGGCAGCTCGCCATC
ATCGGGGACGACATCAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTG
CAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAG
AGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTA
CACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGAC
TTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCC
CTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTG
GGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 212
End on reference sequence 847
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BAK1
Symbol Nomenclature : BAK1
SYNONYM : BAK; BAK-LIKE; BCL2L7; CDN1
Designation : BCL2-like 7 protein|apoptosis regulator BAK|bcl-2 homologous antagonist/killer|bcl-2-like protein 7|bcl2-L-7|pro-apoptotic protein BAK
Full Nomenclature : BCL2-antagonist/killer 1
GENEID : 578
GI : 60655624
GenBank Accession : AY889585
HGNC : 949
MIM : 600516
Vega : OTTHUMG00000014530
Target GenBank: BC004431

 

Reference Sequence Alignment

  

HsCD00003287      ATGGCTTCGGGGCAAGGCCCAGGTCCTCCCAGGCAGGAGTGCGGAGAGCCTGCCCTGCCC
NM_001188.3       ATGGCTTCGGGGCAAGGCCCAGGTCCTCCCAGGCAGGAGTGCGGAGAGCCTGCCCTGCCC
                  ************************************************************

HsCD00003287      TCTGCTTCTGAGGAGCAGGTAGCCCAGGACACAGAGGAGGTTTTCCGCAGCTACGTTTTT
NM_001188.3       TCTGCTTCTGAGGAGCAGGTAGCCCAGGACACAGAGGAGGTTTTCCGCAGCTACGTTTTT
                  ************************************************************

HsCD00003287      TACCGCCATCAGCAGGAACAGGAGGCTGAAGGGGTGGCTGCCCCTGCCGACCCAGAGATG
NM_001188.3       TACCGCCATCAGCAGGAACAGGAGGCTGAAGGGGTGGCTGCCCCTGCCGACCCAGAGATG
                  ************************************************************

HsCD00003287      GTCACCTTACCTCTGCAACCTAGCAGCACCATGGGGCAGGTGGGACGGCAGCTCGCCATC
NM_001188.3       GTCACCTTACCTCTGCAACCTAGCAGCACCATGGGGCAGGTGGGACGGCAGCTCGCCATC
                  ************************************************************

HsCD00003287      ATCGGGGACGACATCAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTG
NM_001188.3       ATCGGGGACGACATCAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTG
                  ************************************************************

HsCD00003287      CAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAG
NM_001188.3       CAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAG
                  ************************************************************

HsCD00003287      AGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTA
NM_001188.3       AGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTA
                  ************************************************************

HsCD00003287      CACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGAC
NM_001188.3       CACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGAC
                  ************************************************************

HsCD00003287      TTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCC
NM_001188.3       TTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCC
                  ************************************************************

HsCD00003287      CTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTG
NM_001188.3       CTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTG
                  ************************************************************

HsCD00003287      GGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGA
NM_001188.3       GGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGA
                  ************************************

Pathways

NCI : Direct p53 effectors
NCI : p73 transcription factor network
Panther : Apoptosis signaling pathway
Reactome : Activation and oligomerization of BAK protein
Reactome : Apoptosis
Reactome : Intrinsic Pathway for Apoptosis
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Integrated Breast Cancer Pathway

Protein

SMART domain : BCL : BCL (B-Cell lymphoma); contains BH1, BH2 regions
UniProt : Q16611
HPRD : 02744

Clone

Cloning Information : 117380
HIP Master Clone ID : 93226
Original Clone ID : FLH117380.01X

Organism


TAX_ID : 9606
Species Specific ID: 578

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000030110

Reagents

Labome : Bak-antibody