DNASU Plasmid Repository • 480.965.5697 | Email

CRK (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CRK
Gene Name:  v-crk avian sarcoma virus CT10 oncogene homolog
Sequence             
Original Clone ID: FLH269135.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329400

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 915nts         Open reading frame : 1 to 915
Reference Sequence Alignment

ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGCGGTTGAGTCGG
CAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
AGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTAC
ATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCC
GGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTA
CTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGA
TCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGA
ATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGG
ATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCC
AGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
GAGGACTTCAGCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1048
Start on reference sequence 134
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CRK
Symbol Nomenclature : CRK
SYNONYM : CRKII; p38
Designation : adapter molecule crk|proto-oncogene c-Crk
Full Nomenclature : v-crk avian sarcoma virus CT10 oncogene homolog
GENEID : 1398
HGNC : 2362
MIM : 164762
Vega : OTTHUMG00000090317
Target GenBank: BC008506

 

Reference Sequence Alignment

  

HsCD00329400      ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGCGGTTGAGTCGG
NM_016823.3       ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGG
                  ************************************************.***********

HsCD00329400      CAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
NM_016823.3       CAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
                  ************************************************************

HsCD00329400      AGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTAC
NM_016823.3       AGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTAC
                  ************************************************************

HsCD00329400      ATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCC
NM_016823.3       ATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCC
                  ************************************************************

HsCD00329400      GGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTA
NM_016823.3       GGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTA
                  ************************************************************

HsCD00329400      CTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGA
NM_016823.3       CTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGA
                  ************************************************************

HsCD00329400      TCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
NM_016823.3       TCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
                  ************************************************************

HsCD00329400      TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGA
NM_016823.3       TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGA
                  ************************************************************

HsCD00329400      ATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGG
NM_016823.3       ATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGG
                  ************************************************************

HsCD00329400      ATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
NM_016823.3       ATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
                  ************************************************************

HsCD00329400      ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
NM_016823.3       ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
                  ************************************************************

HsCD00329400      TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCC
NM_016823.3       TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCC
                  ************************************************************

HsCD00329400      AGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
NM_016823.3       AGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
                  ************************************************************

HsCD00329400      GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
NM_016823.3       GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
                  ************************************************************

HsCD00329400      GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
NM_016823.3       GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
                  ************************************************************

HsCD00329400      GAGGACTTCAGCTTG
NM_016823.3       GAGGACTTCAGCTGA
                  ************* .

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : CXCR4-mediated signaling events
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHA forward signaling
NCI : Endothelins
NCI : IGF1 pathway
NCI : JNK signaling in the CD4+ TCR pathway
NCI : LPA receptor mediated events
NCI : Nectin adhesion pathway
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : RAC1 signaling pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : VEGFR3 signaling in lymphatic endothelium
Panther : Angiogenesis
Panther : Integrin signalling pathway
Reactome : ARMS-mediated activation
Reactome : Cytokine Signaling in Immune system
Reactome : Downstream signal transduction
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Prolonged ERK activation events
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : Regulation of signaling by CBL
Reactome : Signal Transduction
Reactome : Signal attenuation
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : p130Cas linkage to MAPK signaling for integrins
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : angiogenesis overview

Protein

SMART domain : SH2 : Src homology 2 domains
SMART domain : SH3 : Src homology 3 domains
UniProt : P46108
HPRD : 01267

Clone

Cloning Information : 269135
HIP Master Clone ID : 143204
Original Clone ID : FLH269135.01L

Organism


TAX_ID : 9606
Species Specific ID: 1398

Genome

Chromosome : 17
Map Location : 17p13.3
Ensembl : ENSG00000167193

Reagents

Labome : Crk-antibody