DNASU Plasmid Repository • 480.965.5697 | Email

CDK9 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK9
Gene Name:  cyclin-dependent kinase 9
Sequence             
Original Clone ID: FLH269137.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329402

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1119nts         Open reading frame : 1 to 1119
Reference Sequence Alignment

ATGGCGAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1179
Start on reference sequence 61
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK9
Symbol Nomenclature : CDK9
SYNONYM : C-2k; CDC2L4; CTK1; PITALRE; TAK
Designation : CDC2-related kinase|cell division cycle 2-like protein kinase 4|cell division protein kinase 9|serine/threonine protein kinase PITALRE|serine/threonine-protein kinase PITALRE|tat-associated kinase complex catalytic subunit
Full Nomenclature : cyclin-dependent kinase 9
GENEID : 1025
Locus Tag : RP11-228B15.5
HGNC : 1780
MIM : 603251
Vega : OTTHUMG00000020715
Target GenBank: BC001968

 

Reference Sequence Alignment

  

HsCD00329402      ATGGCGAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
NM_001261.3       ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
                  *****.******************************************************

HsCD00329402      AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
NM_001261.3       AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
                  ************************************************************

HsCD00329402      ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
NM_001261.3       ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
                  ************************************************************

HsCD00329402      ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
NM_001261.3       ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
                  ************************************************************

HsCD00329402      TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
NM_001261.3       TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
                  ************************************************************

HsCD00329402      CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
NM_001261.3       CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
                  ************************************************************

HsCD00329402      TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
NM_001261.3       TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
                  ************************************************************

HsCD00329402      CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
NM_001261.3       CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
                  ************************************************************

HsCD00329402      GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
NM_001261.3       GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
                  ************************************************************

HsCD00329402      CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
NM_001261.3       CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
                  ************************************************************

HsCD00329402      CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
NM_001261.3       CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
                  ************************************************************

HsCD00329402      GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
NM_001261.3       GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
                  ************************************************************

HsCD00329402      ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
NM_001261.3       ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
                  ************************************************************

HsCD00329402      CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
NM_001261.3       CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
                  ************************************************************

HsCD00329402      GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
NM_001261.3       GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
                  ************************************************************

HsCD00329402      GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
NM_001261.3       GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
                  ************************************************************

HsCD00329402      CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
NM_001261.3       CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
                  ************************************************************

HsCD00329402      CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
NM_001261.3       CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
                  ************************************************************

HsCD00329402      GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG
NM_001261.3       GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTGA
                  ************************************* .

Pathways

Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV elongation arrest and recovery
Reactome : Host Interactions of HIV factors
Reactome : Interactions of Tat with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : IL-9 signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Clone

Cloning Information : 269137
HIP Master Clone ID : 143384
Original Clone ID : FLH269137.01L

Organism


TAX_ID : 9606
Species Specific ID: 1025

Genome

Chromosome : 9
Map Location : 9q34.1
Ensembl : ENSG00000136807

Reagents

Labome : cdk9-antibody