DNASU Plasmid Repository • 480.965.5697 | Email

PPARG (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPARG
Gene Name:  peroxisome proliferator-activated receptor gamma
Sequence             
Original Clone ID: FLH269140.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329405

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1434nts         Open reading frame : 1 to 1434
Reference Sequence Alignment

ATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTG
GATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACTGTT
GACTTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAGATCCA
GTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAATCAAAGTG
GAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGAA
GAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCTGGA
TTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACAATCAGA
TTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGAAAT
AAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAATGCCATC
AGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTCCAGTGAT
ATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAAACATTTGTATGAC
TCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAAG
ACAACAGACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGAAGAT
AAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCGC
ATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCTGTGCAGGAGATCACAGAGTATGCC
AAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATAT
GGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGTTCTC
ATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAAGCCTTTT
GGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGAT
GACAGCGACTTGGCAATATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTTG
CTGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAG
CTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACA
GACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAG
ACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1555
Start on reference sequence 122
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPARG
Symbol Nomenclature : PPARG
SYNONYM : CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARgamma
Designation : PPAR gamma|PPAR-gamma|nuclear receptor subfamily 1 group C member 3|peroxisome proliferator-activated nuclear receptor gamma variant 1|peroxisome proliferator-activated receptor gamma 1
Full Nomenclature : peroxisome proliferator-activated receptor gamma
GENEID : 5468
HGNC : 9236
MIM : 601487
Vega : OTTHUMG00000129764
Target GenBank: BC006811

 

Reference Sequence Alignment

  

HsCD00329405      ------------------------------------------------------------
NM_005037.5       ------------------------------------------------------------
NM_138712.3       ------------------------------------------------------------
NM_015869.4       ATGGGTGAAACTCTGGGAGATTCTCCTATTGACCCAGAAAGCGATTCCTTCACTGATACA
NM_138711.3       ------------------------------------------------------------
                                                                              

HsCD00329405      ------------------------ATGACCATGGTTGACACAGAGATGCCATTCTGGCCC
NM_005037.5       ------------------------ATGACCATGGTTGACACAGAGATGCCATTCTGGCCC
NM_138712.3       ------------------------ATGACCATGGTTGACACAGAGATGCCATTCTGGCCC
NM_015869.4       CTGTCTGCAAACATATCACAAGAAATGACCATGGTTGACACAGAGATGCCATTCTGGCCC
NM_138711.3       ------------------------ATGACCATGGTTGACACAGAGATGCCATTCTGGCCC
                                          ************************************

HsCD00329405      ACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTT
NM_005037.5       ACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTT
NM_138712.3       ACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTT
NM_015869.4       ACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTT
NM_138711.3       ACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTT
                  ************************************************************

HsCD00329405      GATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGAC
NM_005037.5       GATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGAC
NM_138712.3       GATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGAC
NM_015869.4       GATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGAC
NM_138711.3       GATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGAC
                  ************************************************************

HsCD00329405      ATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAA
NM_005037.5       ATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAA
NM_138712.3       ATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAA
NM_015869.4       ATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAA
NM_138711.3       ATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAA
                  ************************************************************

HsCD00329405      GAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACT
NM_005037.5       GAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACT
NM_138712.3       GAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACT
NM_015869.4       GAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACT
NM_138711.3       GAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACT
                  ************************************************************

HsCD00329405      CAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGT
NM_005037.5       CAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGT
NM_138712.3       CAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGT
NM_015869.4       CAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGT
NM_138711.3       CAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGT
                  ************************************************************

HsCD00329405      GTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAG
NM_005037.5       GTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAG
NM_138712.3       GTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAG
NM_015869.4       GTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAG
NM_138711.3       GTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAG
                  ************************************************************

HsCD00329405      GGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGT
NM_005037.5       GGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGT
NM_138712.3       GGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGT
NM_015869.4       GGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGT
NM_138711.3       GGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGT
                  ************************************************************

HsCD00329405      CGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCA
NM_005037.5       CGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCA
NM_138712.3       CGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCA
NM_015869.4       CGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCA
NM_138711.3       CGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCA
                  ************************************************************

HsCD00329405      GTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAG
NM_005037.5       GTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAG
NM_138712.3       GTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAG
NM_015869.4       GTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAG
NM_138711.3       GTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAG
                  ************************************************************

HsCD00329405      CTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGG
NM_005037.5       CTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGG
NM_138712.3       CTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGG
NM_015869.4       CTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGG
NM_138711.3       CTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGG
                  ************************************************************

HsCD00329405      GCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAG
NM_005037.5       GCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAG
NM_138712.3       GCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAG
NM_015869.4       GCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAG
NM_138711.3       GCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAG
                  ************************************************************

HsCD00329405      GCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATG
NM_005037.5       GCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATG
NM_138712.3       GCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATG
NM_015869.4       GCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATG
NM_138711.3       GCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATG
                  ************************************************************

HsCD00329405      AATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAG
NM_005037.5       AATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAG
NM_138712.3       AATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAG
NM_015869.4       AATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAG
NM_138711.3       AATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAG
                  ************************************************************

HsCD00329405      CAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCT
NM_005037.5       CAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCT
NM_138712.3       CAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCT
NM_015869.4       CAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCT
NM_138711.3       CAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCT
                  ************************************************************

HsCD00329405      GTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAAC
NM_005037.5       GTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAAC
NM_138712.3       GTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAAC
NM_015869.4       GTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAAC
NM_138711.3       GTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAAC
                  ************************************************************

HsCD00329405      GACCAAGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCC
NM_005037.5       GACCAAGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCC
NM_138712.3       GACCAAGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCC
NM_015869.4       GACCAAGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCC
NM_138711.3       GACCAAGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCC
                  ************************************************************

HsCD00329405      TTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTT
NM_005037.5       TTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTT
NM_138712.3       TTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTT
NM_015869.4       TTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTT
NM_138711.3       TTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTT
                  ************************************************************

HsCD00329405      CTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTG
NM_005037.5       CTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTG
NM_138712.3       CTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTG
NM_015869.4       CTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTG
NM_138711.3       CTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTG
                  ************************************************************

HsCD00329405      AAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATT
NM_005037.5       AAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATT
NM_138712.3       AAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATT
NM_015869.4       AAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATT
NM_138711.3       AAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATT
                  ************************************************************

HsCD00329405      CTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAAC
NM_005037.5       CTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAAC
NM_138712.3       CTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAAC
NM_015869.4       CTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAAC
NM_138711.3       CTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAAC
                  ************************************************************

HsCD00329405      CTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTT
NM_005037.5       CTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTT
NM_138712.3       CTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTT
NM_015869.4       CTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTT
NM_138711.3       CTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTT
                  ************************************************************

HsCD00329405      GCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTA
NM_005037.5       GCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTA
NM_138712.3       GCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTA
NM_015869.4       GCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTA
NM_138711.3       GCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTA
                  ************************************************************

HsCD00329405      CTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATC
NM_005037.5       CTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATC
NM_138712.3       CTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATC
NM_015869.4       CTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATC
NM_138711.3       CTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATC
                  ************************************************************

HsCD00329405      TACAAGGACTTGTACTTG
NM_005037.5       TACAAGGACTTGTACTAG
NM_138712.3       TACAAGGACTTGTACTAG
NM_015869.4       TACAAGGACTTGTACTAG
NM_138711.3       TACAAGGACTTGTACTAG
                  ****************:*

Pathways

NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Noncanonical Wnt signaling pathway
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by HDAC Class I
Reactome : Developmental Biology
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Nuclear Receptor transcription pathway
Reactome : PPARA activates gene expression
Reactome : Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha)
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : Adipogenesis
WikiPathway : Energy Metabolism
WikiPathway : Nuclear Receptors
WikiPathway : Nuclear receptors in lipid metabolism and toxicity

Clone

Cloning Information : 269140
HIP Master Clone ID : 142859
Original Clone ID : FLH269140.01L

Organism


TAX_ID : 9606
Species Specific ID: 5468

Genome

Chromosome : 3
Map Location : 3p25
Ensembl : ENSG00000132170

Reagents

Labome : PPARgamma-antibody