DNASU Plasmid Repository • 480.965.5697 | Email

PSMC2 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PSMC2
Gene Name:  proteasome (prosome, macropain) 26S subunit, ATPase, 2
Sequence             
Original Clone ID: FLH268383.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00329493

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1302nts         Open reading frame : 1 to 1302
Reference Sequence Alignment

ATGCCGGATTACCCCGGTGCCGATCAGCGGAAGACCAAAGAGGATGAGAAGGACGACAAG
CCCATCCGAGCTCTGGATGAGGGGGATATTGCCTTGTTGAAAACTTATGGTCAGAGCACT
TACTCTAGGCAGATCAAGCAAGTTGAAGATGACATTCAGCAACTTCTCAAGAAAATTAAT
GAGCTCACTGGTATTAAAGAATCTGACACTGGCCTGGCCCCACCAGCACTCTGGGATTTG
GCTGCAGATAAGCAGACACTCCAGAGTGAACAGCCTTTACAGGTTGCCAGGTGTACAAAG
ATAATCAATGCTGATTCGGAGGACCCAAAATACATTATCAACGTAAAGCAGTTTGCCAAG
TTTGTGGTGGACCTTAGTGATCAGGTGGCACCTACTGACATTGAAGAAGGGATGAGAGTG
GGCGTGGATAGAAATAAATATCAAATTCACATTCCATTGCCTCCTAAGATTGACCCAACA
GTTACCATGATGCAGGTGGAAGAGAAACCTGATGTCACATACAGTGATGTTGGTGGCTGT
AAGGAACAGATTGAGAAACTGCGAGAAGTAGTTGAAACCCCATTACTTCATCCAGAGAGG
TTTGTGAACCTTGGCATTGAGCCTCCCAAGGGCGTGCTGCTCTTTGGTCCACCCGGTACA
GGCAAGACACTCTGTGCGCGGGCAGTTGCTAATCGGACTGATGCGTGCTTCATTCGAGTT
ATTGGATCTGAGCTTGTACAGAAATACGTCGGTGAGGGGGCTCGAATGGTTCGTGAACTC
TTTGAAATGGCCAGAACAAAAAAAGCCTGCCTTATCTTCTTTGATGAAATTGATGCTATT
GGAGGGGCTCGTTTTGATGATGGTGCTGGAGGTGACAATGAAGTGCAGAGAACAATGTTG
GAACTGATCAATCAGCTTGATGGTTTTGATCCTCGAGGCAATATTAAAGTGCTGATGGCC
ACTAACAGACCTGATACTTTGGATCCAGCACTGATGAGGCCAGGGAGATTGGATAGAAAA
ATTGAATTTAGCTTGCCCGATCTAGAGGGTCGGACCCACATATTTAAGATTCACGCTCGT
TCAATGAGTGTTGAAAGAGATATCAGATTTGAACTGTTAGCACGACTGTGTCCAAATAGC
ACTGGTGCTGAGATTAGAAGCGTCTGCACAGAGGCTGGTATGTTTGCCATCAGAGCACGG
CGAAAAATTGCTACCGAGAAGGATTTCTTGGAAGCTGTAAATAAGGTCATTAAGTCTTAT
GCCAAATTCAGTGCTACTCCTCGTTACATGACATACAACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1343
Start on reference sequence 42
Mutations:
None
Discrepancy:
t14c,L5P
                                

5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PSMC2
Symbol Nomenclature : PSMC2
SYNONYM : MSS1; Nbla10058; S7
Designation : 26S protease regulatory subunit 7|26S proteasome AAA-ATPase subunit RPT1|mammalian suppressor of sgv-1 of yeast|protease 26S subunit 7|proteasome 26S subunit ATPase 2|proteasome 26S subunit, ATPase, 2|putative protein product of Nbla10058
Full Nomenclature : proteasome (prosome, macropain) 26S subunit, ATPase, 2
GENEID : 5701
HGNC : 9548
MIM : 154365
Vega : OTTHUMG00000157206
Target GenBank: BC002589

 

Reference Sequence Alignment

  

HsCD00329493      ATGCCGGATTACCCCGGTGCCGATCAGCGGAAGACCAAAGAGGATGAGAAGGACGACAAG
NM_002803.3       ATGCCGGATTACCTCGGTGCCGATCAGCGGAAGACCAAAGAGGATGAGAAGGACGACAAG
                  ************* **********************************************

HsCD00329493      CCCATCCGAGCTCTGGATGAGGGGGATATTGCCTTGTTGAAAACTTATGGTCAGAGCACT
NM_002803.3       CCCATCCGAGCTCTGGATGAGGGGGATATTGCCTTGTTGAAAACTTATGGTCAGAGCACT
                  ************************************************************

HsCD00329493      TACTCTAGGCAGATCAAGCAAGTTGAAGATGACATTCAGCAACTTCTCAAGAAAATTAAT
NM_002803.3       TACTCTAGGCAGATCAAGCAAGTTGAAGATGACATTCAGCAACTTCTCAAGAAAATTAAT
                  ************************************************************

HsCD00329493      GAGCTCACTGGTATTAAAGAATCTGACACTGGCCTGGCCCCACCAGCACTCTGGGATTTG
NM_002803.3       GAGCTCACTGGTATTAAAGAATCTGACACTGGCCTGGCCCCACCAGCACTCTGGGATTTG
                  ************************************************************

HsCD00329493      GCTGCAGATAAGCAGACACTCCAGAGTGAACAGCCTTTACAGGTTGCCAGGTGTACAAAG
NM_002803.3       GCTGCAGATAAGCAGACACTCCAGAGTGAACAGCCTTTACAGGTTGCCAGGTGTACAAAG
                  ************************************************************

HsCD00329493      ATAATCAATGCTGATTCGGAGGACCCAAAATACATTATCAACGTAAAGCAGTTTGCCAAG
NM_002803.3       ATAATCAATGCTGATTCGGAGGACCCAAAATACATTATCAACGTAAAGCAGTTTGCCAAG
                  ************************************************************

HsCD00329493      TTTGTGGTGGACCTTAGTGATCAGGTGGCACCTACTGACATTGAAGAAGGGATGAGAGTG
NM_002803.3       TTTGTGGTGGACCTTAGTGATCAGGTGGCACCTACTGACATTGAAGAAGGGATGAGAGTG
                  ************************************************************

HsCD00329493      GGCGTGGATAGAAATAAATATCAAATTCACATTCCATTGCCTCCTAAGATTGACCCAACA
NM_002803.3       GGCGTGGATAGAAATAAATATCAAATTCACATTCCATTGCCTCCTAAGATTGACCCAACA
                  ************************************************************

HsCD00329493      GTTACCATGATGCAGGTGGAAGAGAAACCTGATGTCACATACAGTGATGTTGGTGGCTGT
NM_002803.3       GTTACCATGATGCAGGTGGAAGAGAAACCTGATGTCACATACAGTGATGTTGGTGGCTGT
                  ************************************************************

HsCD00329493      AAGGAACAGATTGAGAAACTGCGAGAAGTAGTTGAAACCCCATTACTTCATCCAGAGAGG
NM_002803.3       AAGGAACAGATTGAGAAACTGCGAGAAGTAGTTGAAACCCCATTACTTCATCCAGAGAGG
                  ************************************************************

HsCD00329493      TTTGTGAACCTTGGCATTGAGCCTCCCAAGGGCGTGCTGCTCTTTGGTCCACCCGGTACA
NM_002803.3       TTTGTGAACCTTGGCATTGAGCCTCCCAAGGGCGTGCTGCTCTTTGGTCCACCCGGTACA
                  ************************************************************

HsCD00329493      GGCAAGACACTCTGTGCGCGGGCAGTTGCTAATCGGACTGATGCGTGCTTCATTCGAGTT
NM_002803.3       GGCAAGACACTCTGTGCGCGGGCAGTTGCTAATCGGACTGATGCGTGCTTCATTCGAGTT
                  ************************************************************

HsCD00329493      ATTGGATCTGAGCTTGTACAGAAATACGTCGGTGAGGGGGCTCGAATGGTTCGTGAACTC
NM_002803.3       ATTGGATCTGAGCTTGTACAGAAATACGTCGGTGAGGGGGCTCGAATGGTTCGTGAACTC
                  ************************************************************

HsCD00329493      TTTGAAATGGCCAGAACAAAAAAAGCCTGCCTTATCTTCTTTGATGAAATTGATGCTATT
NM_002803.3       TTTGAAATGGCCAGAACAAAAAAAGCCTGCCTTATCTTCTTTGATGAAATTGATGCTATT
                  ************************************************************

HsCD00329493      GGAGGGGCTCGTTTTGATGATGGTGCTGGAGGTGACAATGAAGTGCAGAGAACAATGTTG
NM_002803.3       GGAGGGGCTCGTTTTGATGATGGTGCTGGAGGTGACAATGAAGTGCAGAGAACAATGTTG
                  ************************************************************

HsCD00329493      GAACTGATCAATCAGCTTGATGGTTTTGATCCTCGAGGCAATATTAAAGTGCTGATGGCC
NM_002803.3       GAACTGATCAATCAGCTTGATGGTTTTGATCCTCGAGGCAATATTAAAGTGCTGATGGCC
                  ************************************************************

HsCD00329493      ACTAACAGACCTGATACTTTGGATCCAGCACTGATGAGGCCAGGGAGATTGGATAGAAAA
NM_002803.3       ACTAACAGACCTGATACTTTGGATCCAGCACTGATGAGGCCAGGGAGATTGGATAGAAAA
                  ************************************************************

HsCD00329493      ATTGAATTTAGCTTGCCCGATCTAGAGGGTCGGACCCACATATTTAAGATTCACGCTCGT
NM_002803.3       ATTGAATTTAGCTTGCCCGATCTAGAGGGTCGGACCCACATATTTAAGATTCACGCTCGT
                  ************************************************************

HsCD00329493      TCAATGAGTGTTGAAAGAGATATCAGATTTGAACTGTTAGCACGACTGTGTCCAAATAGC
NM_002803.3       TCAATGAGTGTTGAAAGAGATATCAGATTTGAACTGTTAGCACGACTGTGTCCAAATAGC
                  ************************************************************

HsCD00329493      ACTGGTGCTGAGATTAGAAGCGTCTGCACAGAGGCTGGTATGTTTGCCATCAGAGCACGG
NM_002803.3       ACTGGTGCTGAGATTAGAAGCGTCTGCACAGAGGCTGGTATGTTTGCCATCAGAGCACGG
                  ************************************************************

HsCD00329493      CGAAAAATTGCTACCGAGAAGGATTTCTTGGAAGCTGTAAATAAGGTCATTAAGTCTTAT
NM_002803.3       CGAAAAATTGCTACCGAGAAGGATTTCTTGGAAGCTGTAAATAAGGTCATTAAGTCTTAT
                  ************************************************************

HsCD00329493      GCCAAATTCAGTGCTACTCCTCGTTACATGACATACAACTTG
NM_002803.3       GCCAAATTCAGTGCTACTCCTCGTTACATGACATACAACTGA
                  **************************************** .

Pathways

Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Apoptosis
Reactome : Assembly of the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cross-presentation of soluble exogenous antigens (endosomes)
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : ER-Phagosome pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Orc1 removal from chromatin
Reactome : PCP/CE pathway
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of ornithine decarboxylase (ODC)
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Stabilization of p53
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Proteasome Degradation

Protein

SMART domain : AAA : ATPases associated with a variety of cellular activities
UniProt : B7Z571
UniProt : P35998
HPRD : 01105

Clone

Cloning Information : 268383
HIP Master Clone ID : 194859
Original Clone ID : FLH268383.01L

Organism


TAX_ID : 9606
Species Specific ID: 5701

Genome

Chromosome : 7
Map Location : 7q22.1-q22.3
Ensembl : ENSG00000161057

Reagents

Labome : PSMC2-antibody