DNASU Plasmid Repository • 480.965.5697 | Email

SKP1A (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SKP1
Gene Name:  S-phase kinase-associated protein 1
Sequence             
Original Clone ID: FLH268137.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329680

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 492nts         Open reading frame : 1 to 492
Reference Sequence Alignment

ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATT
GCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGA
GATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAG
TGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGATGATGAGAACAAAGAAAAG
CGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAAGTTGACCAAGGAACACTT
TTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTTACATGC
AAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT
ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACGCAAAGAGAACCAGTGGTGT
GAAGAGAAGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 564
Start on reference sequence 73
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SKP1
Symbol Nomenclature : SKP1
SYNONYM : EMC19; OCP-II; OCP2; SKP1A; TCEB1L; p19A
Designation : OCP-2|RNA polymerase II elongation factor-like protein OCP2|SIII|cyclin A/CDK2-associated p19|cyclin A/CDK2-associated protein p19|cyclin-A/CDK2-associated protein p19|organ of Corti protein 2|organ of Corti protein II|p19skp1|transcription elongation factor B
Full Nomenclature : S-phase kinase-associated protein 1
GENEID : 6500
HGNC : 10899
MIM : 601434
Target GenBank: BC009839

 

Reference Sequence Alignment

  

HsCD00329680      ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATT
NM_006930.3       ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATT
NM_170679.2       ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATT
                  ************************************************************

HsCD00329680      GCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGA
NM_006930.3       GCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGA
NM_170679.2       GCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGA
                  ************************************************************

HsCD00329680      GATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAG
NM_006930.3       GATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAG
NM_170679.2       GATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAG
                  ************************************************************

HsCD00329680      TGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGATGATGAGAACAAAGAAAAG
NM_006930.3       TGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGATGATGAGAACAAAGAAAAG
NM_170679.2       TGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGATGATGAGAACAAAGAAAAG
                  ************************************************************

HsCD00329680      CGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAAGTTGACCAAGGAACACTT
NM_006930.3       CGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAAGTTGACCAAGGAACACTT
NM_170679.2       CGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAAGTTGACCAAGGAACACTT
                  ************************************************************

HsCD00329680      TTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTTACATGC
NM_006930.3       TTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTTACATGC
NM_170679.2       TTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGATGTTACATGC
                  ************************************************************

HsCD00329680      AAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT
NM_006930.3       AAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT
NM_170679.2       AAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT
                  ************************************************************

HsCD00329680      ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACGCAAAGAGAACCAGTGGTGT
NM_006930.3       ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTAGGTAGCACACAGTTTTGTCTT
NM_170679.2       ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACGCAAAGAGAACCAGTGGTGT
                  *************************************** * *......*  : **   *

HsCD00329680      GAAGAGAAGTTG
NM_006930.3       TGA---------
NM_170679.2       GAAGAGAAGTGA
                   .*         

Pathways

NCI : Degradation of beta catenin
NCI : Notch signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Circadian Clock
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Interleukin-1 signaling
Reactome : Loss of Function of FBXW7 in Cancer and NOTCH1 Signaling
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Nuclear signaling by ERBB4
Reactome : Prolactin receptor signaling
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : Signal Transduction
Reactome : Signaling by ERBB4
Reactome : Signaling by Interleukins
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Vpu mediated degradation of CD4
WikiPathway : Notch Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway

Protein

SMART domain : Skp1 : Found in Skp1 protein family
UniProt : P63208
HPRD : 03255

Clone

Cloning Information : 268137
HIP Master Clone ID : 193177
Original Clone ID : FLH268137.01L

Organism


TAX_ID : 9606
Species Specific ID: 6500

Genome

Chromosome : 5
Map Location : 5q31

Reagents

Labome : Skp1-antibody