DNASU Plasmid Repository • 480.965.5697 | Email

BID (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BID
Gene Name:  BH3 interacting domain death agonist
Sequence             
Original Clone ID: FLH268443.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329710

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 726nts         Open reading frame : 1 to 726
Reference Sequence Alignment

ATGTGCAGCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGGGCCGGGCCGGCTGG
AGGAGCACAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAGGAGTGAGTCGGAGC
TGCCGCGCTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
CTGGCCAAGAAGGTGGCCAGTCAAACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
GTGAACTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
GACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1054
Start on reference sequence 329
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BID
Symbol Nomenclature : BID
SYNONYM : FP497
Designation : BH3-interacting domain death agonist|BID isoform ES(1b)|BID isoform L(2)|BID isoform Si6|Human BID coding sequence|apoptic death agonist|desmocollin type 4|p22 BID
Full Nomenclature : BH3 interacting domain death agonist
GENEID : 637
HGNC : 1050
MIM : 601997
Vega : OTTHUMG00000150087
Target GenBank: BC036364

 

Reference Sequence Alignment

  

HsCD00329710      ATGTGCAGCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGGGCCGGGCCGGCTGG
NM_197966.2       ATGTGCAGCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGGGCCGGGCCGGCTGG
                  ************************************************************

HsCD00329710      AGGAGCACAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAGGAGTGAGTCGGAGC
NM_197966.2       AGGAGCACAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAGGAGTGAGTCGGAGC
                  ************************************************************

HsCD00329710      TGCCGCGCTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_197966.2       TGCCGCGCTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
                  ************************************************************

HsCD00329710      TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_197966.2       TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
                  ************************************************************

HsCD00329710      AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_197966.2       AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
                  ************************************************************

HsCD00329710      GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_197966.2       GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
                  ************************************************************

HsCD00329710      GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_197966.2       GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
                  ************************************************************

HsCD00329710      GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_197966.2       GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
                  ************************************************************

HsCD00329710      AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_197966.2       AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
                  ************************************************************

HsCD00329710      CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_197966.2       CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
                  ************************************************************

HsCD00329710      CTGGCCAAGAAGGTGGCCAGTCAAACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_197966.2       CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
                  ***********************.************************************

HsCD00329710      GTGAACTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_197966.2       GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
                  ***** ******************************************************

HsCD00329710      GACTTG
NM_197966.2       GACTGA
                  **** .

Pathways

NCI : ATM pathway
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : Direct p53 effectors
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
Reactome : Activation and oligomerization of BAK protein
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Activation, myristolyation of BID and translocation to mitochondria
Reactome : Activation, translocation and oligomerization of BAX
Reactome : Apoptosis
Reactome : BH3-only proteins associate with and inactivate anti-apoptotic BCL-2 members
Reactome : Intrinsic Pathway for Apoptosis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response

Protein

UniProt : B2ZP79
UniProt : A8ASI8
UniProt : B3KT21
UniProt : P55957
HPRD : 03590

Clone

Cloning Information : 268443
HIP Master Clone ID : 193459
Original Clone ID : FLH268443.01L

Organism


TAX_ID : 9606
Species Specific ID: 637

Genome

Chromosome : 22
Map Location : 22q11.1
Ensembl : ENSG00000015475

Reagents

Labome : Bid-antibody