DNASU Plasmid Repository • 480.965.5697 | Email

NPAS4 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NPAS4
Gene Name:  neuronal PAS domain protein 4
Sequence             
Original Clone ID: FLH268517.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00329776

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2409nts         Open reading frame : 1 to 2409
Reference Sequence Alignment

ATGTACCGCTCCACCAAGGGCGCCTCCAAGGCGCGCCGGGACCAGATCAACGCCGAGATC
CGGAACCTCAAGGAGCTGCTGCCGCTGGCCGAAGCGGACAAGGTCCGGCTGTCCTACCTG
CACATCATGAGCCTCGCCTGCATCTACACTCGCAAGGGCGTCTTCTTCGCTGGTGGCACT
CCTCTGGCGGGCCCCACGGGGCTTCTCTCAGCTCAAGAGCTTGAGGACATCGTAGCGGCA
CTACCCGGCTTTCTGCTTGTGTTCACAGCCGAGGGGAAATTGCTCTACCTGTCTGAGAGT
GTGAGCGAGCATCTGGGCCACTCCATGGTGGACCTGGTTGCCCAGGGTGACAGCATCTAC
GACATCATTGACCCAGCTGACCACCTCACTGTGCGCCAGCAACTCACCCTGCCCTCTGCC
CTGGACACTGATCGCCTCTTCCGCTGCCGCTTCAACACCTCCAAGTCCCTCAGGCGCCAG
AGTGCAGGCAACAAACTCGTGCTTATTCGAGGCCGATTCCATGCTCACCCACCTGGAGCC
TACTGGGCAGGAAATCCCGTGTTCACAGCTTTCTGTGCCCCTCTGGAGCCGAGACCCCGC
CCAGGTCCTGGCCCTGGCCCTGGCCCTGCCTCGCTCTTCCTGGCCATGTTCCAGAGCCGC
CATGCTAAAGACCTGGCTCTACTGGACATCTCCGAGAGTGTCCTAATCTACCTGGGCTTT
GAGCGCAGTGAACTGCTTTGTAAATCATGGTATGGACTGCTGCACCCCGAGGACCTGGCC
CACGCTTCTGCTCAACACTACCGCCTGTTGGCTGAGAGTGGAGATATTCAGGCAGAGATG
GTGGTGAGGCTACAGGCCAAGACTGGAGGCTGGGCATGGATTTACTGCCTGTTATACTCA
GAAGGTCCAGAGGGACCCATTACTGCCAATAACTACCCAATCAGTGACATGGAAGCCTGG
AGCCTCCGCCAGCAGTTGAACTCTGAAGACACCCAGGCAGCTTATGTCCTGGGCACTCCG
ACCATGCTGCCCTCATTCCCTGAAAACATTCTTTCCCAGGAAGAGTGCTCCAGCACTAAC
CCACTCTTCACCGCAGCACTGGGGGCTCCCAGAAGCACCAGCTTCCCCAGTGCTCCTGAA
CTGAGTGTTGTCTCTGCATCAGAAGAGCTTCCCCGACCCTCCAAAGAACTGGACTTCAGT
TACCTGACATTCCCTTCTGGGCCTGAGCCTTCTCTCCAAGCAGAACTAAGCAAGGATCTT
GTGTGCACTCCACCTTACACGCCCCATCAGCCAGGAGGCTGTGCCTTCCTCTTCAGCCTC
CATGAGCCCTTCCAGACCCATTTGCCCACCCCATCCAGCACTCTTCAAGAACAGCTGACT
CCAAGCACTGCGACCTTCTCTGATCAGTTGACGCCCAGCAGTGCAACCTTCCCAGATCCA
CTAACTAGCCCACTGCAAGGCCAGTTGACTGAAACCTCGGTCAGAAGCTATGAAGACCAG
TTGACTCCCTGCACCTCCACCTTCCCAGACCAGCTGCTTCCCAGCACAGCCACCTTCCCA
GAGCCACTGGGCAGCCCTGCCCATGAACAGCTGACTCCTCCCAGCACAGCATTCCAAGCA
CACCTGGACAGCCCCAGCCAAACCTTCCCAGAGCAACTGAGCCCCAACCCTACCAAGACT
TACTTTGCCCAGGAGGGATGCAGTTTTCTCTATGAGAAGTTGCCCCCAAGTCCTAGCAGC
CCTGGTAATGGGGACTGCACGCTCTTGGCCCTAGCCCAGCTCCGGGGCCCCCTCTCTGTG
GATGTCCCCCTGGTGCCCGAAGGCCTGCTCACACCTGAGGCCTCTCCAGTCAAGCAGAGT
TTCTTCCACTACTCTGAAAAGGAGCAGAATGAGATAGACCGTCTCATCCAGCAGATTAGC
CAATTGGCTCAGGGCATGGACAGACCCTTCTCAGCTGAGGCTGGCACTGGCGGACTAGAG
CCACTTGGAGGACTGGAGCCCCTGGACTCCAACCTGTCCCTGTCAGGGGCAGGCCCCCCT
GTGCTCAGCCTGGACCTGAAACCCTGGAAATGCCAGGAGCTGGACTTCCTGGCTGACCCT
GATAACATGTTCCTGGAAGAGACGCCCGTGGAAGACATCTTCATGGATCTCTCTACCCCA
GATCCCAGTGAGGAATGGGGCTCAGGGGATCCTGAGGCAGAGGGCCCAGGAGGGGCCCCA
TCGCCTTGCAACAACCTGTCCCCAGAAGACCACAGCTTCCTGGAGGACCTGGCCACATAT
GAAACCGCCTTTGAGACAGGTGTCTCAGCATTCCCCTATGATGGGTTTACTGATGAGTTG
CATCAACTCCAGAGCCAAGTTCAAGACAGCTTCCATGAAGATGGAAGTGGAGGGGAACCA
ACGTTTTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2498
Start on reference sequence 90
Mutations:
None
Discrepancy:
t1566a
                                

5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NPAS4
Symbol Nomenclature : NPAS4
SYNONYM : Le-PAS; NXF; PASD10; bHLHe79
Designation : HLH-PAS transcription factor NXF|PAS domain-containing protein 10|class E basic helix-loop-helix protein 79|neuronal PAS domain-containing protein 4|neuronal PAS4
Full Nomenclature : neuronal PAS domain protein 4
GENEID : 266743
HGNC : 18983
MIM : 608554
Vega : OTTHUMG00000167045
Target GenBank: BC105001

 

Reference Sequence Alignment

  

HsCD00329776      ATGTACCGCTCCACCAAGGGCGCCTCCAAGGCGCGCCGGGACCAGATCAACGCCGAGATC
NM_178864.3       ATGTACCGCTCCACCAAGGGCGCCTCCAAGGCGCGCCGGGACCAGATCAACGCCGAGATC
                  ************************************************************

HsCD00329776      CGGAACCTCAAGGAGCTGCTGCCGCTGGCCGAAGCGGACAAGGTCCGGCTGTCCTACCTG
NM_178864.3       CGGAACCTCAAGGAGCTGCTGCCGCTGGCCGAAGCGGACAAGGTCCGGCTGTCCTACCTG
                  ************************************************************

HsCD00329776      CACATCATGAGCCTCGCCTGCATCTACACTCGCAAGGGCGTCTTCTTCGCTGGTGGCACT
NM_178864.3       CACATCATGAGCCTCGCCTGCATCTACACTCGCAAGGGCGTCTTCTTCGCTGGTGGCACT
                  ************************************************************

HsCD00329776      CCTCTGGCGGGCCCCACGGGGCTTCTCTCAGCTCAAGAGCTTGAGGACATCGTAGCGGCA
NM_178864.3       CCTCTGGCGGGCCCCACGGGGCTTCTCTCAGCTCAAGAGCTTGAGGACATCGTAGCGGCA
                  ************************************************************

HsCD00329776      CTACCCGGCTTTCTGCTTGTGTTCACAGCCGAGGGGAAATTGCTCTACCTGTCTGAGAGT
NM_178864.3       CTACCCGGCTTTCTGCTTGTGTTCACAGCCGAGGGGAAATTGCTCTACCTGTCTGAGAGT
                  ************************************************************

HsCD00329776      GTGAGCGAGCATCTGGGCCACTCCATGGTGGACCTGGTTGCCCAGGGTGACAGCATCTAC
NM_178864.3       GTGAGCGAGCATCTGGGCCACTCCATGGTGGACCTGGTTGCCCAGGGTGACAGCATCTAC
                  ************************************************************

HsCD00329776      GACATCATTGACCCAGCTGACCACCTCACTGTGCGCCAGCAACTCACCCTGCCCTCTGCC
NM_178864.3       GACATCATTGACCCAGCTGACCACCTCACTGTGCGCCAGCAACTCACCCTGCCCTCTGCC
                  ************************************************************

HsCD00329776      CTGGACACTGATCGCCTCTTCCGCTGCCGCTTCAACACCTCCAAGTCCCTCAGGCGCCAG
NM_178864.3       CTGGACACTGATCGCCTCTTCCGCTGCCGCTTCAACACCTCCAAGTCCCTCAGGCGCCAG
                  ************************************************************

HsCD00329776      AGTGCAGGCAACAAACTCGTGCTTATTCGAGGCCGATTCCATGCTCACCCACCTGGAGCC
NM_178864.3       AGTGCAGGCAACAAACTCGTGCTTATTCGAGGCCGATTCCATGCTCACCCACCTGGAGCC
                  ************************************************************

HsCD00329776      TACTGGGCAGGAAATCCCGTGTTCACAGCTTTCTGTGCCCCTCTGGAGCCGAGACCCCGC
NM_178864.3       TACTGGGCAGGAAATCCCGTGTTCACAGCTTTCTGTGCCCCTCTGGAGCCGAGACCCCGC
                  ************************************************************

HsCD00329776      CCAGGTCCTGGCCCTGGCCCTGGCCCTGCCTCGCTCTTCCTGGCCATGTTCCAGAGCCGC
NM_178864.3       CCAGGTCCTGGCCCTGGCCCTGGCCCTGCCTCGCTCTTCCTGGCCATGTTCCAGAGCCGC
                  ************************************************************

HsCD00329776      CATGCTAAAGACCTGGCTCTACTGGACATCTCCGAGAGTGTCCTAATCTACCTGGGCTTT
NM_178864.3       CATGCTAAAGACCTGGCTCTACTGGACATCTCCGAGAGTGTCCTAATCTACCTGGGCTTT
                  ************************************************************

HsCD00329776      GAGCGCAGTGAACTGCTTTGTAAATCATGGTATGGACTGCTGCACCCCGAGGACCTGGCC
NM_178864.3       GAGCGCAGTGAACTGCTTTGTAAATCATGGTATGGACTGCTGCACCCCGAGGACCTGGCC
                  ************************************************************

HsCD00329776      CACGCTTCTGCTCAACACTACCGCCTGTTGGCTGAGAGTGGAGATATTCAGGCAGAGATG
NM_178864.3       CACGCTTCTGCTCAACACTACCGCCTGTTGGCTGAGAGTGGAGATATTCAGGCAGAGATG
                  ************************************************************

HsCD00329776      GTGGTGAGGCTACAGGCCAAGACTGGAGGCTGGGCATGGATTTACTGCCTGTTATACTCA
NM_178864.3       GTGGTGAGGCTACAGGCCAAGACTGGAGGCTGGGCATGGATTTACTGCCTGTTATACTCA
                  ************************************************************

HsCD00329776      GAAGGTCCAGAGGGACCCATTACTGCCAATAACTACCCAATCAGTGACATGGAAGCCTGG
NM_178864.3       GAAGGTCCAGAGGGACCCATTACTGCCAATAACTACCCAATCAGTGACATGGAAGCCTGG
                  ************************************************************

HsCD00329776      AGCCTCCGCCAGCAGTTGAACTCTGAAGACACCCAGGCAGCTTATGTCCTGGGCACTCCG
NM_178864.3       AGCCTCCGCCAGCAGTTGAACTCTGAAGACACCCAGGCAGCTTATGTCCTGGGCACTCCG
                  ************************************************************

HsCD00329776      ACCATGCTGCCCTCATTCCCTGAAAACATTCTTTCCCAGGAAGAGTGCTCCAGCACTAAC
NM_178864.3       ACCATGCTGCCCTCATTCCCTGAAAACATTCTTTCCCAGGAAGAGTGCTCCAGCACTAAC
                  ************************************************************

HsCD00329776      CCACTCTTCACCGCAGCACTGGGGGCTCCCAGAAGCACCAGCTTCCCCAGTGCTCCTGAA
NM_178864.3       CCACTCTTCACCGCAGCACTGGGGGCTCCCAGAAGCACCAGCTTCCCCAGTGCTCCTGAA
                  ************************************************************

HsCD00329776      CTGAGTGTTGTCTCTGCATCAGAAGAGCTTCCCCGACCCTCCAAAGAACTGGACTTCAGT
NM_178864.3       CTGAGTGTTGTCTCTGCATCAGAAGAGCTTCCCCGACCCTCCAAAGAACTGGACTTCAGT
                  ************************************************************

HsCD00329776      TACCTGACATTCCCTTCTGGGCCTGAGCCTTCTCTCCAAGCAGAACTAAGCAAGGATCTT
NM_178864.3       TACCTGACATTCCCTTCTGGGCCTGAGCCTTCTCTCCAAGCAGAACTAAGCAAGGATCTT
                  ************************************************************

HsCD00329776      GTGTGCACTCCACCTTACACGCCCCATCAGCCAGGAGGCTGTGCCTTCCTCTTCAGCCTC
NM_178864.3       GTGTGCACTCCACCTTACACGCCCCATCAGCCAGGAGGCTGTGCCTTCCTCTTCAGCCTC
                  ************************************************************

HsCD00329776      CATGAGCCCTTCCAGACCCATTTGCCCACCCCATCCAGCACTCTTCAAGAACAGCTGACT
NM_178864.3       CATGAGCCCTTCCAGACCCATTTGCCCACCCCATCCAGCACTCTTCAAGAACAGCTGACT
                  ************************************************************

HsCD00329776      CCAAGCACTGCGACCTTCTCTGATCAGTTGACGCCCAGCAGTGCAACCTTCCCAGATCCA
NM_178864.3       CCAAGCACTGCGACCTTCTCTGATCAGTTGACGCCCAGCAGTGCAACCTTCCCAGATCCA
                  ************************************************************

HsCD00329776      CTAACTAGCCCACTGCAAGGCCAGTTGACTGAAACCTCGGTCAGAAGCTATGAAGACCAG
NM_178864.3       CTAACTAGCCCACTGCAAGGCCAGTTGACTGAAACCTCGGTCAGAAGCTATGAAGACCAG
                  ************************************************************

HsCD00329776      TTGACTCCCTGCACCTCCACCTTCCCAGACCAGCTGCTTCCCAGCACAGCCACCTTCCCA
NM_178864.3       TTGACTCCCTGCACCTCCACCTTCCCAGACCAGCTGCTTCCCAGCACAGCCACCTTCCCA
                  ************************************************************

HsCD00329776      GAGCCACTGGGCAGCCCTGCCCATGAACAGCTGACTCCTCCCAGCACAGCATTCCAAGCA
NM_178864.3       GAGCCTCTGGGCAGCCCTGCCCATGAACAGCTGACTCCTCCCAGCACAGCATTCCAAGCA
                  *****:******************************************************

HsCD00329776      CACCTGGACAGCCCCAGCCAAACCTTCCCAGAGCAACTGAGCCCCAACCCTACCAAGACT
NM_178864.3       CACCTGGACAGCCCCAGCCAAACCTTCCCAGAGCAACTGAGCCCCAACCCTACCAAGACT
                  ************************************************************

HsCD00329776      TACTTTGCCCAGGAGGGATGCAGTTTTCTCTATGAGAAGTTGCCCCCAAGTCCTAGCAGC
NM_178864.3       TACTTTGCCCAGGAGGGATGCAGTTTTCTCTATGAGAAGTTGCCCCCAAGTCCTAGCAGC
                  ************************************************************

HsCD00329776      CCTGGTAATGGGGACTGCACGCTCTTGGCCCTAGCCCAGCTCCGGGGCCCCCTCTCTGTG
NM_178864.3       CCTGGTAATGGGGACTGCACGCTCTTGGCCCTAGCCCAGCTCCGGGGCCCCCTCTCTGTG
                  ************************************************************

HsCD00329776      GATGTCCCCCTGGTGCCCGAAGGCCTGCTCACACCTGAGGCCTCTCCAGTCAAGCAGAGT
NM_178864.3       GATGTCCCCCTGGTGCCCGAAGGCCTGCTCACACCTGAGGCCTCTCCAGTCAAGCAGAGT
                  ************************************************************

HsCD00329776      TTCTTCCACTACTCTGAAAAGGAGCAGAATGAGATAGACCGTCTCATCCAGCAGATTAGC
NM_178864.3       TTCTTCCACTACTCTGAAAAGGAGCAGAATGAGATAGACCGTCTCATCCAGCAGATTAGC
                  ************************************************************

HsCD00329776      CAATTGGCTCAGGGCATGGACAGACCCTTCTCAGCTGAGGCTGGCACTGGCGGACTAGAG
NM_178864.3       CAATTGGCTCAGGGCATGGACAGACCCTTCTCAGCTGAGGCTGGCACTGGCGGACTAGAG
                  ************************************************************

HsCD00329776      CCACTTGGAGGACTGGAGCCCCTGGACTCCAACCTGTCCCTGTCAGGGGCAGGCCCCCCT
NM_178864.3       CCACTTGGAGGACTGGAGCCCCTGGACTCCAACCTGTCCCTGTCAGGGGCAGGCCCCCCT
                  ************************************************************

HsCD00329776      GTGCTCAGCCTGGACCTGAAACCCTGGAAATGCCAGGAGCTGGACTTCCTGGCTGACCCT
NM_178864.3       GTGCTCAGCCTGGACCTGAAACCCTGGAAATGCCAGGAGCTGGACTTCCTGGCTGACCCT
                  ************************************************************

HsCD00329776      GATAACATGTTCCTGGAAGAGACGCCCGTGGAAGACATCTTCATGGATCTCTCTACCCCA
NM_178864.3       GATAACATGTTCCTGGAAGAGACGCCCGTGGAAGACATCTTCATGGATCTCTCTACCCCA
                  ************************************************************

HsCD00329776      GATCCCAGTGAGGAATGGGGCTCAGGGGATCCTGAGGCAGAGGGCCCAGGAGGGGCCCCA
NM_178864.3       GATCCCAGTGAGGAATGGGGCTCAGGGGATCCTGAGGCAGAGGGCCCAGGAGGGGCCCCA
                  ************************************************************

HsCD00329776      TCGCCTTGCAACAACCTGTCCCCAGAAGACCACAGCTTCCTGGAGGACCTGGCCACATAT
NM_178864.3       TCGCCTTGCAACAACCTGTCCCCAGAAGACCACAGCTTCCTGGAGGACCTGGCCACATAT
                  ************************************************************

HsCD00329776      GAAACCGCCTTTGAGACAGGTGTCTCAGCATTCCCCTATGATGGGTTTACTGATGAGTTG
NM_178864.3       GAAACCGCCTTTGAGACAGGTGTCTCAGCATTCCCCTATGATGGGTTTACTGATGAGTTG
                  ************************************************************

HsCD00329776      CATCAACTCCAGAGCCAAGTTCAAGACAGCTTCCATGAAGATGGAAGTGGAGGGGAACCA
NM_178864.3       CATCAACTCCAGAGCCAAGTTCAAGACAGCTTCCATGAAGATGGAAGTGGAGGGGAACCA
                  ************************************************************

HsCD00329776      ACGTTTTTG
NM_178864.3       ACGTTTTGA
                  ******* .

Protein

SMART domain : PAS : PAS domain
UniProt : Q8IUM7
HPRD : 12260

Clone

Cloning Information : 268517
HIP Master Clone ID : 193601
Original Clone ID : FLH268517.01L

Organism


TAX_ID : 9606
Species Specific ID: 266743

Genome

Chromosome : 11
Map Location : 11q13
Ensembl : ENSG00000174576

Reagents

Labome : NXF-antibody