DNASU Plasmid Repository • 480.965.5697 | Email

MEF2C (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MEF2C
Gene Name:  myocyte enhancer factor 2C
Sequence             
Original Clone ID: FLH268521.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329780

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1410nts         Open reading frame : 1 to 1410
Reference Sequence Alignment

ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCAGCATGAGAGCCGGACA
AACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGAC
CCCGATGCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATT
AACGAAGATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAAC
TTCGAGATGCCAGTCTCCATCCCAGTGTCCAGTCACAACAGTTTGGTGTACAGCAACCCT
GTCAGCTCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAAT
AGTATGTCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATG
GGTGGAGACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGA
AACTCACCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCT
CCTCCCCCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCA
CCAGGCAGCAAGAATACGATGCCATCAGTGTCTGAGGATGTCGACCTGCTTTTGAATCAA
AGGATAAATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACT
CCTACTTTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGT
ACCGAGTACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGC
GCTCTTCACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCAACCA
TCTGCCCTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTC
TCCCTGCCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGAC
CGTACCACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCT
GTTGACAGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGG
AACGAATTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCC
TCAGTCAAGCGCATGCGACTTTCTGAATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1836
Start on reference sequence 427
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MEF2C
Symbol Nomenclature : MEF2C
SYNONYM : C5DELq14.3; DEL5q14.3
Designation : MADS box transcription enhancer factor 2, polypeptide C|myocyte-specific enhancer factor 2C
Full Nomenclature : myocyte enhancer factor 2C
GENEID : 4208
HGNC : 6996
MIM : 600662
Vega : OTTHUMG00000162634
Target GenBank: BC026341

 

Reference Sequence Alignment

  

HsCD00329780        ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
XM_005248511.1      ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
NM_001131005.2      ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
NM_002397.4         ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
NM_001193347.1      ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
NM_001193350.1      ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
                    ************************************************************

HsCD00329780        TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
XM_005248511.1      TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
NM_001131005.2      TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
NM_002397.4         TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
NM_001193347.1      TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
NM_001193350.1      TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
                    ************************************************************

HsCD00329780        TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
XM_005248511.1      TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
NM_001131005.2      TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
NM_002397.4         TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
NM_001193347.1      TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
NM_001193350.1      TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
                    ************************************************************

HsCD00329780        GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCAGCATGAGAGCCGGACA
XM_005248511.1      GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACA
NM_001131005.2      GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACA
NM_002397.4         GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACA
NM_001193347.1      GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACA
NM_001193350.1      GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACA
                    *******************************************.****************

HsCD00329780        AACTCAGACATCGTGGAGACG---------------------------------------
XM_005248511.1      AACTCAGACATCGTGGAGACG---------------------------------------
NM_001131005.2      AACTCAGACATCGTG---------------------------------------------
NM_002397.4         AACTCAGACATCGTGGAGACG---------------------------------------
NM_001193347.1      AACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGAC
NM_001193350.1      AACTCAGACATCGTGGAGACG---------------------------------------
                    ***************                                             

HsCD00329780        ---------------TTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGAT
XM_005248511.1      ---------------TTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGAT
NM_001131005.2      ---------------GAGGCATTGAACAAGAAAGAAAACAAAGGCTGTGAAAGCCCCGAT
NM_002397.4         ---------------TTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGAT
NM_001193347.1      CCCGATGCGGACGATTCCGCATTGAACAAGAAAGAAAACAAAGGCTGTGAAAGCCCCGAT
NM_001193350.1      ---------------TTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGAT
                                      . *::*** .. .::.*:..*:.:*.*:*  .*..*******

HsCD00329780        GCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAA
XM_005248511.1      GCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAA
NM_001131005.2      CCCGACTCCTCTTATGCACTCACCCCACGCACTGAAGAAAAATACAAAAAAATTAATGAA
NM_002397.4         GCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAA
NM_001193347.1      CCCGACTCCTCTTATGCACTCACCCCACGCACTGAAGAAAAATACAAAAAAATTAATGAA
NM_001193350.1      GCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAA
                     * *** . **  ::* :*:** ***: . :****.**.**.****..******** ***

HsCD00329780        GATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAG
XM_005248511.1      GATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAG
NM_001131005.2      GAATTTGATAATATGATCAAGAGTCATAAAATTCCTGCTGTTCCACCTCCCAACTTCGAG
NM_002397.4         GATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAG
NM_001193347.1      GAATTTGATAATATGATCAAGAGTCATAAAATTCCTGCTGTTCCACCTCCCAACTTCGAG
NM_001193350.1      GATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAG
                    **::*****.::*******. ** **:*.*:*   *************************

HsCD00329780        ATGCCAGTCTCCATCCCAGTGTCCAGTCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
XM_005248511.1      ATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
NM_001131005.2      ATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
NM_002397.4         ATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
NM_001193347.1      ATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
NM_001193350.1      ATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
                    ************************** *********************************

HsCD00329780        TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
XM_005248511.1      TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
NM_001131005.2      TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
NM_002397.4         TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
NM_001193347.1      TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
NM_001193350.1      TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
                    ************************************************************

HsCD00329780        TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
XM_005248511.1      TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
NM_001131005.2      TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
NM_002397.4         TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
NM_001193347.1      TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
NM_001193350.1      TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
                    ************************************************************

HsCD00329780        GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
XM_005248511.1      GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
NM_001131005.2      GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
NM_002397.4         GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
NM_001193347.1      GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
NM_001193350.1      GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
                    ************************************************************

HsCD00329780        CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
XM_005248511.1      CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
NM_001131005.2      CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
NM_002397.4         CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
NM_001193347.1      CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
NM_001193350.1      CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
                    ************************************************************

HsCD00329780        CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
XM_005248511.1      CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
NM_001131005.2      CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
NM_002397.4         CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
NM_001193347.1      CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
NM_001193350.1      CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
                    ************************************************************

HsCD00329780        AGCAAGAATACGATGCCATCAGTGTCTGAGGATGTCGACCTGCTTTTGAATCAAAGGATA
XM_005248511.1      AGCAAGAATACGATGCCATCAGTGTCTGAGGATGTCGACCTGCTTTTGAATCAAAGGATA
NM_001131005.2      AGCAAGAATACGATGCCATCAGTG------------------------AATCAAAGGATA
NM_002397.4         AGCAAGAATACGATGCCATCAGTGTCTGAGGATGTCGACCTGCTTTTGAATCAAAGGATA
NM_001193347.1      AGCAAGAATACGATGCCATCAGTG------------------------AATCAAAGGATA
NM_001193350.1      AGCAAGAATACGATGCCATCAGTGTCTGAGGATGTCGACCTGCTTTTGAATCAAAGGATA
                    ************************                        ************

HsCD00329780        AATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACT
XM_005248511.1      AATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACT
NM_001131005.2      AATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACT
NM_002397.4         AATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACT
NM_001193347.1      AATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACT
NM_001193350.1      AATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACT
                    ************************************************************

HsCD00329780        TTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACCGAG
XM_005248511.1      TTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACCGAG
NM_001131005.2      TTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACCGAG
NM_002397.4         TTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACCGAG
NM_001193347.1      TTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACCGAG
NM_001193350.1      TTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACCGAG
                    ************************************************************

HsCD00329780        TACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTT
XM_005248511.1      TACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTT
NM_001131005.2      TACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTT
NM_002397.4         TACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTT
NM_001193347.1      TACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTT
NM_001193350.1      TACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTT
                    ************************************************************

HsCD00329780        CACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCAACCATCTGCC
XM_005248511.1      CACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTGCC
NM_001131005.2      CACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTGCC
NM_002397.4         CACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTGCC
NM_001193347.1      CACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTGCC
NM_001193350.1      CACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTGCC
                    *************************************************.**********

HsCD00329780        CTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTG
XM_005248511.1      CTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTG
NM_001131005.2      CTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTG
NM_002397.4         CTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTG
NM_001193347.1      CTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTG
NM_001193350.1      CTCAGTCAGTTGGGAGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTG
                    ************************************************************

HsCD00329780        CCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACC
XM_005248511.1      CCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACC
NM_001131005.2      CCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACC
NM_002397.4         CCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACC
NM_001193347.1      CCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACC
NM_001193350.1      CCTTCTACTCAAAGCCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACC
                    ************************************************************

HsCD00329780        ACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGAC
XM_005248511.1      ACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGAC
NM_001131005.2      ACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGAC
NM_002397.4         ACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGAC
NM_001193347.1      ACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGAC
NM_001193350.1      ACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGAC
                    ************************************************************

HsCD00329780        AGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAA
XM_005248511.1      AGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAA
NM_001131005.2      AGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAA
NM_002397.4         AGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAA
NM_001193347.1      AGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAA
NM_001193350.1      AGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAA
                    ************************************************************

HsCD00329780        TTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTC
XM_005248511.1      TTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTC
NM_001131005.2      TTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTC
NM_002397.4         TTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTC
NM_001193347.1      TTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTC
NM_001193350.1      TTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTC
                    ************************************************************

HsCD00329780        AAGCGCATGCGACTTTCTGAATTG------------
XM_005248511.1      AAGCGCATGCGACTTTCTGAAGGATGGGCAACATGA
NM_001131005.2      AAGCGCATGCGACTTTCTGAAGGATGGGCAACATGA
NM_002397.4         AAGCGCATGCGACTTTCTGAAGGATGGGCAACATGA
NM_001193347.1      AAGCGCATGCGACTTTCTGAAGGATGGGCAACATGA
NM_001193350.1      AAGCGCATGCGACTTTCTGAAGGATGGGCAACATGA
                    *********************  .            

Pathways

NCI : ErbB1 downstream signaling
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by HDAC Class II
NCI : Signaling mediated by p38-alpha and p38-beta
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Oxidative stress response
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : CDO in myogenesis
Reactome : Circadian Clock
Reactome : Developmental Biology
Reactome : ERK/MAPK targets
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Mitochondrial biogenesis
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myogenesis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Organelle biogenesis and maintenance
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcriptional activation of mitochondrial biogenesis
WikiPathway : Adipogenesis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Cell Differentiation - Index
WikiPathway : Cell Differentiation - meta
WikiPathway : Endochondral Ossification
WikiPathway : Energy Metabolism
WikiPathway : Heart Development
WikiPathway : MAPK signaling pathway
WikiPathway : Proteins and DNA Sequences in Cardicac Structures
WikiPathway : SRF and miRs in Smooth Muscle Differentiation and Proliferation
WikiPathway : TGF beta Signaling Pathway
WikiPathway : miRs in Muscle Cell Differentiation

Protein

SMART domain : MADS :
UniProt : E9PAZ7
UniProt : D8L7E9
UniProt : D7F7N5
UniProt : Q06413
UniProt : C9JMZ0
HPRD : 02809

Clone

Cloning Information : 268521
HIP Master Clone ID : 194761
Original Clone ID : FLH268521.01L

Organism


TAX_ID : 9606
Species Specific ID: 4208

Genome

Chromosome : 5
Map Location : 5q14.3
Ensembl : ENSG00000081189

Reagents

Labome : MEF2C-antibody