DNASU Plasmid Repository • 480.965.5697 | Email

HDAC1 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HDAC1
Gene Name:  histone deacetylase 1
Sequence             
Original Clone ID: FLH269322.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329826

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1449nts         Open reading frame : 1 to 1449
Reference Sequence Alignment

ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGA
AATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCATAAT
TTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAAT
GCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGT
CCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGT
CCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGT
GCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCAC
CATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATC
CTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCATGGT
GACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCATAAG
TATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGCAAG
TATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCCATT
TTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTACAG
TGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAAGGA
CACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGAGGC
GGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCCCTG
GATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCAGAT
TTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAG
AAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTCCAA
ATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGAC
CCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAGTTC
TCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAAGCC
AAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTCACC
GAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTCAAG
TTGGCCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1492
Start on reference sequence 44
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HDAC1
Symbol Nomenclature : HDAC1
SYNONYM : GON-10; HD1; RPD3; RPD3L1
Designation : reduced potassium dependency, yeast homolog-like 1
Full Nomenclature : histone deacetylase 1
GENEID : 3065
Locus Tag : RP4-811H24.2
HGNC : 4852
MIM : 601241
Vega : OTTHUMG00000007529
Target GenBank: BC000301

 

Reference Sequence Alignment

  

HsCD00329826      ---ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTT
NM_001527.3       ATGGCGTACAGTCAAGGAGGCGGCAAAAAAAAAGTCTGCTACTACTACGACGGTGATATT
NM_004964.2       ---ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTT
                     . * . .. ... ..***. *...*..******** ************** ***.**

HsCD00329826      GGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCAT
NM_001527.3       GGAAATTATTATTATGGACAGGGTCATCCCATGAAGCCTCATAGAATCCGCATGACCCAT
NM_004964.2       GGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCAT
                  ******** ***********.** ** **.*********** .************* ***

HsCD00329826      AATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCC
NM_001527.3       AACTTGCTGTTAAATTATGGCTTATACAGAAAAATGGAAATATATAGGCCCCATAAAGCC
NM_004964.2       AATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCC
                  ** ****** *.** *****  *.***.*************.***.* ** ** ******

HsCD00329826      AATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATC
NM_001527.3       ACTGCCGAAGAAATGACAAAATATCACAGTGATGAGTATATCAAATTTCTACGGTCAATA
NM_004964.2       AATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATC
                  *.*** **.**.*****.**.** ***** ***** ** ** *****  *.** **.**.

HsCD00329826      CGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGAC
NM_001527.3       AGACCAGATAACATGTCTGAGTATAGTAAGCAGATGCAGAGATTTAATGTTGGAGAAGAT
NM_004964.2       CGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGAC
                  .*:************** ***** ** ***************** ** *****:**.** 

HsCD00329826      TGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCA
NM_001527.3       TGTCCAGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCAACTGGCGGTTCAGTTGCT
NM_004964.2       TGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCA
                  ********.** *****.** ******** ****** * **:***** *****:** **:

HsCD00329826      AGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTG
NM_001527.3       GGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTA
NM_004964.2       AGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTG
                  .*:********. *:** ...**.***** ** ** ***** ***********.**. *.

HsCD00329826      CACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCC
NM_001527.3       CATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCC
NM_004964.2       CACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCC
                  ** *****:*****.**.**.*****:**.*********** ******** **  * ***

HsCD00329826      ATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCAT
NM_001527.3       ATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCAT
NM_004964.2       ATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCAT
                  ***** *** *.*********** *****.**  *.** ***** **:******** ***

HsCD00329826      GGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCAT
NM_001527.3       GGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCAT
NM_004964.2       GGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCAT
                  ***** ** ** *****.** ** ** **.**.** ** **.***** **.**.** ***

HsCD00329826      AAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGC
NM_001527.3       AAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGC
NM_004964.2       AAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGC
                  **.*****.**.***** **:**.**:**.*** *..******* ** *****.******

HsCD00329826      AAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCC
NM_001527.3       AAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAG
NM_004964.2       AAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCC
                  **.** ******** ** *: **..* .**** ** **:***** *****.****.* . 

HsCD00329826      ATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTA
NM_001527.3       ATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTA
NM_004964.2       ATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTA
                  **:** ***** .* ** **.**.**.**********: **.******** *****.***

HsCD00329826      CAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAA
NM_001527.3       CAGTGTGGTGCAGACTCATTATCTGGTGATAGACTGGGTTGTTTCAATCTAACAGTCAAA
NM_004964.2       CAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAA
                  ********  *******. ******* ***.*. *.***** ***********:.*****

HsCD00329826      GGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGA
NM_001527.3       GGTCATGCTAAATGTGTAGAAGTTGTAAAAACTTTTAACTTACCATTACTGATGCTTGGA
NM_004964.2       GGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGA
                  **:** ** **.*****.*** ****.**.*  ****** *.**::*.******** ***

HsCD00329826      GGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
NM_001527.3       GGAGGTGGCTACACAATCCGTAATGTTGCTCGATGTTGGACATATGAGACTGCAGTTGCC
NM_004964.2       GGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
                  **.***** *****.** ***** ***** **.** **************:**:** ***

HsCD00329826      CTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCA
NM_001527.3       CTTGATTGTGAGATTCCCAATGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCA
NM_004964.2       CTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCA
                  ** ***:  ***** ** ****** * ***** ***** ********.** *********

HsCD00329826      GATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTG
NM_001527.3       GACTTCAAACTGCATATTAGTCCTTCAAACATGACAAACCAGAACACTCCAGAATATATG
NM_004964.2       GATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTG
                  ** *****.** ** ** ********.** *****:*********** ..:**.** .**

HsCD00329826      GAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTC
NM_001527.3       GAAAAGATAAAACAGCGTTTGTTTGAAAATTTGCGCATGTTACCTCATGCACCTGGTGTC
NM_004964.2       GAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTC
                  **.*****.********: *******.**  * .*.*** *.** ** ******** ***

HsCD00329826      CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGAC
NM_001527.3       CAGATGCAAGCTATTCCAGAAGATGCTGTTCATGAAGACAGTGGAGATGAAGATGGAGAA
NM_004964.2       CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGAC
                  **.*****.** *****:**.** ** .* *.***.** *****.*****.** *.***.

HsCD00329826      GACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAG
NM_001527.3       GATCCAGACAAGAGAATTTCTATTCGAGCATCAGACAAGCGGATAGCTTGTGATGAAGAA
NM_004964.2       GACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAG
                  ** **:******.*.** ** **  *. *.**:*****.**.**:** ***** *****.

HsCD00329826      TTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAA
NM_001527.3       TTCTCAGATTCTGAGGATGAAGGAGAAGGAGGTCGAAGAAATGTGGCTGATCATAAGAAA
NM_004964.2       TTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAA
                  *****.********.** **.*****.**.** **.*..**     * .*  : **.***

HsCD00329826      GCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTC
NM_001527.3       GGAGCAAAGAAAGCTAGAATTGAAGAAGATAAGAAAGAAACAGAGGACAAAAAAACAGAC
NM_004964.2       GCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTC
                  * ....*...:...:* *.: **:***.*:.*******..******* **.***..**:*

HsCD00329826      ACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTC
NM_001527.3       GTTAAGGAAGAAGATAAATCCAAGGACAACAGTGGTGAAAAAACAGATACCAAAGGAACC
NM_004964.2       ACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTC
                  .  .*.**.**..*:*..:. .**** ** . :*.:*..***. .*: *. .*.*... *

HsCD00329826      AAGTTGGCCTTG---------------
NM_001527.3       AAATCAGAACAGCTCAGCAACCCCTGA
NM_004964.2       AAGTTGGCCTGA---------------
                  **.* .*..  .               

Pathways

NCI : E2F transcription factor network
NCI : Glucocorticoid receptor regulatory network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IL3-mediated signaling events
NCI : Notch signaling pathway
NCI : Notch-mediated HES/HEY network
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of Androgen receptor activity
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of retinoblastoma protein
NCI : Retinoic acid receptors-mediated signaling
NCI : Signaling events mediated by HDAC Class I
NCI : Sumoylation by RanBP2 regulates transcriptional repression
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
Panther : Wnt signaling pathway
Panther : p53 pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Disease
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Epigenetic regulation of gene expression
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G0 and Early G1
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Hemostasis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Mitotic G1-G1/S phases
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : TCF dependent signaling in response to WNT
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcription
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : formation of the beta-catenin:TCF transactivating complex
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR negatively regulates cell cycle via SC1
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : Energy Metabolism
WikiPathway : IL-6 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TWEAK Signaling Pathway

Protein

UniProt : Q6IT96
UniProt : Q13547
HPRD : 03143

Clone

Cloning Information : 269322
HIP Master Clone ID : 151716
Original Clone ID : FLH269322.01L

Organism


TAX_ID : 9606
Species Specific ID: 3065

Genome

Chromosome : 1
Map Location : 1p34
Ensembl : ENSG00000116478

Reagents

Labome : HDAC1-antibody