DNASU Plasmid Repository • 480.965.5697 | Email

TFDP1 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TFDP1
Gene Name:  transcription factor Dp-1
Sequence             
Original Clone ID: FLH269324.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329828

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1233nts         Open reading frame : 1 to 1233
Reference Sequence Alignment

ATGGCAAAAGATGCCGGTCTAATTGAAGCCAACGGAGAACTCAAGGTCTTCATAGACCAG
AACCTTAGTCCCGGGAAAGGCGTGGTGTCCCTCGTGGCCGTTCACCCCTCCACCGTCAAC
CCGCTCGGGAAGCAGCTCTTGCCAAAAACCTTTGGACAGTCCAATGTCAACATTGCCCAG
CAAGTGGTAATTGGTACGCCTCAGAGACCGGCAGCGTCAAACACCCTGGTGGTAGGAAGC
CCACACACCCCCAGCACTCACTTTGCCTCTCAGAACCAGCCTTCCGACTCCTCACCTTGG
TCTGCCGGGAAGCGCAACAGGAAAGGAGAGAAGAATGGCAAGGGCCTACGGCATTTCTCC
ATGAAGGTCTGCGAGAAGGTGCAGAGGAAAGGGACCACTTCCTACAACGAAGTGGCAGAC
GAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTAT
GACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAAC
ATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAG
GAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAG
TCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAAC
CGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCC
TTCATCATCGTCAACACCAGCAAGAAGACGGTCATCGACTGCAGCATCTCCAATGACAAA
TTTGAGTATCTGTTTAATTTTGACAACACATTTGAAATCCACGATGACATAGAAGTGCTG
AAGCGGATGGGCATGGCTTGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAA
ATGGCCAGAAGTCTGGTCCCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGA
ACTGTTGGAGGCGTGTTCATCACGACGGCAGGTTCCACGTCTAACGGCACAAGGTTCTCT
GCCAGTGACCTGACCAACGGTGCAGATGGGATGCTGGCCACAAGCTCCAATGGGTCTCAG
TACAGCGGCTCCAGGGTGGAGACTCCGGTGTCCTACGTCGGGGAGGACGACGAGGAGGAC
GATGACTTCAACGAGAATGACGAGGACGACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1454
Start on reference sequence 222
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TFDP1
Symbol Nomenclature : TFDP1
SYNONYM : DP1; DRTF1; Dp-1
Designation : DRTF1-polypeptide 1|E2F dimerization partner 1|E2F-related transcription factor
Full Nomenclature : transcription factor Dp-1
GENEID : 7027
Locus Tag : RP11-230F18.1
HGNC : 11749
MIM : 189902
Vega : OTTHUMG00000017388
Target GenBank: BC011685

 

Reference Sequence Alignment

  

HsCD00329828        ATGGCAAAAGATGCCGGTCTAATTGAAGCCAACGGAGAACTCAAGGTCTTCATAGACCAG
XM_005268328.1      ATGGCAAAAGATGCCGGTCTAATTGAAGCCAACGGAGAACTCAAGGTCTTCATAGACCAG
NM_007111.4         ATGGCAAAAGATGCCGGTCTAATTGAAGCCAACGGAGAACTCAAGGTCTTCATAGACCAG
XM_005268326.1      ATGGCAAAAGATGCCGGTCTAATTGAAGCCAACGGAGAACTCAAGGTCTTCATAGACCAG
XM_005268327.1      ATGGCAAAAGATGCCGGTCTAATTGAAGCCAACGGAGAACTCAAGGTCTTCATAGACCAG
                    ************************************************************

HsCD00329828        AACCTTAGTCCCGGGAAAGGCGTGGTGTCCCTCGTGGCCGTTCACCCCTCCACCGTCAAC
XM_005268328.1      AACCTTAGTCCCGGGAAAGGCGTGGTGTCCCTCGTGGCCGTTCACCCCTCCACCGTCAAC
NM_007111.4         AACCTTAGTCCCGGGAAAGGCGTGGTGTCCCTCGTGGCCGTTCACCCCTCCACCGTCAAC
XM_005268326.1      AACCTTAGTCCCGGGAAAGGCGTGGTGTCCCTCGTGGCCGTTCACCCCTCCACCGTCAAC
XM_005268327.1      AACCTTAGTCCCGGGAAAGGCGTGGTGTCCCTCGTGGCCGTTCACCCCTCCACCGTCAAC
                    ************************************************************

HsCD00329828        CCGCTCGGGAAGCAGCTCTTGCCAAAAACCTTTGGACAGTCCAATGTCAACATTGCCCAG
XM_005268328.1      CCGCTCGGGAAGCAGCTCTTGCCAAAAACCTTTGGACAGTCCAATGTCAACATTGCCCAG
NM_007111.4         CCGCTCGGGAAGCAGCTCTTGCCAAAAACCTTTGGACAGTCCAATGTCAACATTGCCCAG
XM_005268326.1      CCGCTCGGGAAGCAGCTCTTGCCAAAAACCTTTGGACAGTCCAATGTCAACATTGCCCAG
XM_005268327.1      CCGCTCGGGAAGCAGCTCTTGCCAAAAACCTTTGGACAGTCCAATGTCAACATTGCCCAG
                    ************************************************************

HsCD00329828        CAAGTGGTAATTGGTACGCCTCAGAGACCGGCAGCGTCAAACACCCTGGTGGTAGGAAGC
XM_005268328.1      CAAGTGGTAATTGGTACGCCTCAGAGACCGGCAGCGTCAAACACCCTGGTGGTAGGAAGC
NM_007111.4         CAAGTGGTAATTGGTACGCCTCAGAGACCGGCAGCGTCAAACACCCTGGTGGTAGGAAGC
XM_005268326.1      CAAGTGGTAATTGGTACGCCTCAGAGACCGGCAGCGTCAAACACCCTGGTGGTAGGAAGC
XM_005268327.1      CAAGTGGTAATTGGTACGCCTCAGAGACCGGCAGCGTCAAACACCCTGGTGGTAGGAAGC
                    ************************************************************

HsCD00329828        CCACACACCCCCAGCACTCACTTTGCCTCTCAGAACCAGCCTTCCGACTCCTCACCTTGG
XM_005268328.1      CCACACACCCCCAGCACTCACTTTGCCTCTCAGAACCAGCCTTCCGACTCCTCACCTTGG
NM_007111.4         CCACACACCCCCAGCACTCACTTTGCCTCTCAGAACCAGCCTTCCGACTCCTCACCTTGG
XM_005268326.1      CCACACACCCCCAGCACTCACTTTGCCTCTCAGAACCAGCCTTCCGACTCCTCACCTTGG
XM_005268327.1      CCACACACCCCCAGCACTCACTTTGCCTCTCAGAACCAGCCTTCCGACTCCTCACCTTGG
                    ************************************************************

HsCD00329828        TCTGCCGGGAAGCGCAACAGGAAAGGAGAGAAGAATGGCAAGGGCCTACGGCATTTCTCC
XM_005268328.1      TCTGCCGGGAAGCGCAACAGGAAAGGAGAGAAGAATGGCAAGGGCCTACGGCATTTCTCC
NM_007111.4         TCTGCCGGGAAGCGCAACAGGAAAGGAGAGAAGAATGGCAAGGGCCTACGGCATTTCTCC
XM_005268326.1      TCTGCCGGGAAGCGCAACAGGAAAGGAGAGAAGAATGGCAAGGGCCTACGGCATTTCTCC
XM_005268327.1      TCTGCCGGGAAGCGCAACAGGAAAGGAGAGAAGAATGGCAAGGGCCTACGGCATTTCTCC
                    ************************************************************

HsCD00329828        ATGAAGGTCTGCGAGAAGGTGCAGAGGAAAGGGACCACTTCCTACAACGAAGTGGCAGAC
XM_005268328.1      ATGAAGGTCTGCGAGAAGGTGCAGAGGAAAGGGACCACTTCCTACAACGAAGTGGCAGAC
NM_007111.4         ATGAAGGTCTGCGAGAAGGTGCAGAGGAAAGGGACCACTTCCTACAACGAAGTGGCAGAC
XM_005268326.1      ATGAAGGTCTGCGAGAAGGTGCAGAGGAAAGGGACCACTTCCTACAACGAAGTGGCAGAC
XM_005268327.1      ATGAAGGTCTGCGAGAAGGTGCAGAGGAAAGGGACCACTTCCTACAACGAAGTGGCAGAC
                    ************************************************************

HsCD00329828        GAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTAT
XM_005268328.1      GAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTAT
NM_007111.4         GAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTAT
XM_005268326.1      GAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTAT
XM_005268327.1      GAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTAT
                    ************************************************************

HsCD00329828        GACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAAC
XM_005268328.1      GACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAAC
NM_007111.4         GACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAAC
XM_005268326.1      GACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAAC
XM_005268327.1      GACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAAC
                    ************************************************************

HsCD00329828        ATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAG
XM_005268328.1      ATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAG
NM_007111.4         ATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAG
XM_005268326.1      ATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAG
XM_005268327.1      ATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAG
                    ************************************************************

HsCD00329828        GAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAG
XM_005268328.1      GAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAG
NM_007111.4         GAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAG
XM_005268326.1      GAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAG
XM_005268327.1      GAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAG
                    ************************************************************

HsCD00329828        TCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAAC
XM_005268328.1      TCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAAC
NM_007111.4         TCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAAC
XM_005268326.1      TCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAAC
XM_005268327.1      TCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAAC
                    ************************************************************

HsCD00329828        CGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCC
XM_005268328.1      CGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCC
NM_007111.4         CGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCC
XM_005268326.1      CGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCC
XM_005268327.1      CGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCC
                    ************************************************************

HsCD00329828        TTCATCATCGTCAACACCAGCAAGAAGACGGTCATCGACTGCAGCATCTCCAATGACAAA
XM_005268328.1      TTCATCATCGTCAACACCAGCAAGAAGACGGTCATCGACTGCAGCATCTCCAATGACAAA
NM_007111.4         TTCATCATCGTCAACACCAGCAAGAAGACGGTCATCGACTGCAGCATCTCCAATGACAAA
XM_005268326.1      TTCATCATCGTCAACACCAGCAAGAAGACGGTCATCGACTGCAGCATCTCCAATGACAAA
XM_005268327.1      TTCATCATCGTCAACACCAGCAAGAAGACGGTCATCGACTGCAGCATCTCCAATGACAAA
                    ************************************************************

HsCD00329828        TTTGAGTATCTGTTTAATTTTGACAACACATTTGAAATCCACGATGACATAGAAGTGCTG
XM_005268328.1      TTTGAGTATCTGTTTAATTTTGACAACACATTTGAAATCCACGATGACATAGAAGTGCTG
NM_007111.4         TTTGAGTATCTGTTTAATTTTGACAACACATTTGAAATCCACGATGACATAGAAGTGCTG
XM_005268326.1      TTTGAGTATCTGTTTAATTTTGACAACACATTTGAAATCCACGATGACATAGAAGTGCTG
XM_005268327.1      TTTGAGTATCTGTTTAATTTTGACAACACATTTGAAATCCACGATGACATAGAAGTGCTG
                    ************************************************************

HsCD00329828        AAGCGGATGGGCATGGCTTGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAA
XM_005268328.1      AAGCGGATGGGCATGGCTTGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAA
NM_007111.4         AAGCGGATGGGCATGGCTTGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAA
XM_005268326.1      AAGCGGATGGGCATGGCTTGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAA
XM_005268327.1      AAGCGGATGGGCATGGCTTGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAA
                    ************************************************************

HsCD00329828        ATGGCCAGAAGTCTGGTCCCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGA
XM_005268328.1      ATGGCCAGAAGTCTGGTCCCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGA
NM_007111.4         ATGGCCAGAAGTCTGGTCCCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGA
XM_005268326.1      ATGGCCAGAAGTCTGGTCCCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGA
XM_005268327.1      ATGGCCAGAAGTCTGGTCCCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGA
                    ************************************************************

HsCD00329828        ACTGTTGGAGGCGTGTTCATCACGACGGCAGGTTCCACGTCTAACGGCACAAGGTTCTCT
XM_005268328.1      ACTGTTGGAGGCGTGTTCATCACGACGGCAGGTTCCACGTCTAACGGCACAAG-------
NM_007111.4         ACTGTTGGAGGCGTGTTCATCACGACGGCAGGTTCCACGTCTAACGGCACAAGGTTCTCT
XM_005268326.1      ACTGTTGGAGGCGTGTTCATCACGACGGCAGGTTCCACGTCTAACGGCACAAGGTTCTCT
XM_005268327.1      ACTGTTGGAGGCGTGTTCATCACGACGGCAGGTTCCACGTCTAACGGCACAAGGTTCTCT
                    *****************************************************       

HsCD00329828        GCCAGTGACCTGACCAACGGTGCAGATGGGATGCTGGCCACAAGCTCCAATGGGTCTCAG
XM_005268328.1      -----TGACCTGACCAACGGTGCAGATGGGATGCTGGCCACAAGCTCCAATGGGTCTCAG
NM_007111.4         GCCAGTGACCTGACCAACGGTGCAGATGGGATGCTGGCCACAAGCTCCAATGGGTCTCAG
XM_005268326.1      GCCAGTGACCTGACCAACGGTGCAGATGGGATGCTGGCCACAAGCTCCAATGGGTCTCAG
XM_005268327.1      GCCAGTGACCTGACCAACGGTGCAGATGGGATGCTGGCCACAAGCTCCAATGGGTCTCAG
                         *******************************************************

HsCD00329828        TACAGCGGCTCCAGGGTGGAGACTCCGGTGTCCTACGTCGGGGAGGACGACGAGGAGGAC
XM_005268328.1      TACAGCGGCTCCAGGGTGGAGACTCCGGTGTCCTACGTCGGGGAGGACGACGAGGAGGAC
NM_007111.4         TACAGCGGCTCCAGGGTGGAGACTCCGGTGTCCTACGTCGGGGAGGACGACGAGGAGGAC
XM_005268326.1      TACAGCGGCTCCAGGGTGGAGACTCCGGTGTCCTACGTCGGGGAGGACGACGAGGAGGAC
XM_005268327.1      TACAGCGGCTCCAGGGTGGAGACTCCGGTGTCCTACGTCGGGGAGGACGACGAGGAGGAC
                    ************************************************************

HsCD00329828        GATGACTTCAACGAGAATGACGAGGACGACTTG
XM_005268328.1      GATGACTTCAACGAGAATGACGAGGACGACTGA
NM_007111.4         GATGACTTCAACGAGAATGACGAGGACGACTGA
XM_005268326.1      GATGACTTCAACGAGAATGACGAGGACGACTGA
XM_005268327.1      GATGACTTCAACGAGAATGACGAGGACGACTGA
                    ******************************* .

Pathways

NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
Reactome : Activation of BH3-only proteins
Reactome : Activation of NOXA and translocation to mitochondria
Reactome : Activation of PUMA and translocation to mitochondria
Reactome : Apoptosis
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cyclin D associated events in G1
Reactome : Disease
Reactome : E2F mediated regulation of DNA replication
Reactome : G0 and Early G1
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Inhibition of replication initiation of damaged DNA by RB1/E2F1
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Mitotic G1-G1/S phases
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : Pre-NOTCH Expression and Processing
Reactome : Pre-NOTCH Transcription and Translation
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : Cell cycle
WikiPathway : G1 to S cell cycle control
WikiPathway : TGF beta Signaling Pathway

Protein

SMART domain : DP : Transcription factor DP
UniProt : Q14186
HPRD : 01792

Clone

Cloning Information : 269324
HIP Master Clone ID : 165364
Original Clone ID : FLH269324.01L

Organism


TAX_ID : 9606
Species Specific ID: 7027

Genome

Chromosome : 13
Map Location : 13q34
Ensembl : ENSG00000198176

Reagents

Labome : TFDP1-antibody