DNASU Plasmid Repository • 480.965.5697 | Email

HCK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HCK
Gene Name:  hemopoietic cell kinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000247.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000331

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1518nts         Open reading frame : 1 to 1518
Reference Sequence Alignment

ATGGGGTCGATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACTGAA
ACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAGCCG
GGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAGGCAGGCTCTGAGGACATC
ATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTCCAGAAG
GGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCCCTGGCC
ACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAGACA
GAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCTCCC
GGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTACTCT
TTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATCCGG
ACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAGGAG
CTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTGCCCTGC
ATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGGGAATCC
CTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTAC
AACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAGGCC
TTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTTCAT
GCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCTTG
CTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGACTTC
TCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGAGAC
CTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGACTTTGGC
CTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCCATC
AAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTCTGG
TCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGGATG
TCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAGAAC
TGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAGCGG
CCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAGAGCCAG
TACCAACAGCAGCCATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1686
Start on reference sequence 169
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HCK
Symbol Nomenclature : HCK
SYNONYM : JTK9; p59Hck; p61Hck
Designation : hematopoietic cell kinase|p59-HCK/p60-HCK|tyrosine-protein kinase HCK
Full Nomenclature : hemopoietic cell kinase
GENEID : 3055
Locus Tag : RP5-836N17.3
GI : 33304206
GenBank Accession : AY335784
HGNC : 4840
MIM : 142370
Vega : OTTHUMG00000032204
Target GenBank: NM_002110

 

Reference Sequence Alignment

  

HsCD00000331        ------------------------------------------------------------
NM_001172130.1      CTGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCC
NM_001172129.1      ------------------------------------------------------------
NM_001172132.1      ------------------------------------------------------------
NM_001172133.1      ------------------------------------------------------------
NM_001172131.1      ------------------------------------------------------------
NM_002110.3         CTGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCC
                                                                                

HsCD00000331        ---ATGGGGTCGATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172130.1      AGGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172129.1      ---ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172132.1      ATGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172133.1      ---ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172131.1      ---ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_002110.3         AGGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
                       *******  ************************************************

HsCD00000331        GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172130.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172129.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172132.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172133.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172131.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_002110.3         GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
                    ************************************************************

HsCD00000331        CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172130.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAG---GGCTCTGAG
NM_001172129.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172132.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172133.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172131.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAG------GGCTCTGAG
NM_002110.3         CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
                    ******************************************         *********

HsCD00000331        GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172130.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172129.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172132.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172133.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172131.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_002110.3         GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
                    ************************************************************

HsCD00000331        CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172130.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172129.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172132.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172133.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172131.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_002110.3         CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
                    ************************************************************

HsCD00000331        CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172130.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172129.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172132.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172133.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172131.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_002110.3         CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
                    ************************************************************

HsCD00000331        GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172130.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172129.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172132.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172133.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172131.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_002110.3         GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
                    ************************************************************

HsCD00000331        GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172130.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172129.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172132.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172133.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172131.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_002110.3         GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
                    ************************************************************

HsCD00000331        TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172130.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172129.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172132.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172133.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172131.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_002110.3         TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
                    ************************************************************

HsCD00000331        ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172130.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172129.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172132.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172133.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172131.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_002110.3         ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
                    ************************************************************

HsCD00000331        CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172130.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172129.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172132.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172133.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172131.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_002110.3         CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
                    ************************************************************

HsCD00000331        CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172130.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172129.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172132.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172133.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172131.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_002110.3         CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
                    ************************************************************

HsCD00000331        GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172130.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172129.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172132.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172133.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172131.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_002110.3         GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
                    ************************************************************

HsCD00000331        ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172130.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172129.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172132.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172133.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172131.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_002110.3         ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
                    ************************************************************

HsCD00000331        GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172130.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172129.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172132.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172133.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172131.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_002110.3         GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
                    ************************************************************

HsCD00000331        CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172130.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172129.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172132.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172133.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172131.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_002110.3         CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
                    ************************************************************

HsCD00000331        AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172130.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172129.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172132.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172133.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172131.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_002110.3         AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
                    ************************************************************

HsCD00000331        GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172130.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172129.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172132.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172133.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172131.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_002110.3         GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
                    ************************************************************

HsCD00000331        CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172130.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172129.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172132.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172133.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172131.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_002110.3         CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
                    ************************************************************

HsCD00000331        TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172130.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172129.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172132.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172133.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172131.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_002110.3         TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
                    ************************************************************

HsCD00000331        CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172130.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172129.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172132.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172133.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172131.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_002110.3         CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
                    ************************************************************

HsCD00000331        GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172130.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172129.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172132.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172133.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172131.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_002110.3         GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
                    ************************************************************

HsCD00000331        GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172130.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172129.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172132.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172133.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172131.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_002110.3         GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
                    ************************************************************

HsCD00000331        GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172130.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172129.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172132.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172133.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172131.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_002110.3         GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
                    ************************************************************

HsCD00000331        GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172130.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172129.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172132.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172133.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172131.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_002110.3         GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
                    ************************************************************

HsCD00000331        AGCCAGTACCAACAGCAGCCATTG
NM_001172130.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172129.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172132.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172133.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172131.1      AGCCAGTACCAACAGCAGCCATGA
NM_002110.3         AGCCAGTACCAACAGCAGCCATGA
                    ********************** .

Pathways

NCI : Alpha-synuclein signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EPHA forward signaling
NCI : Ephrin B reverse signaling
NCI : Glypican 1 network
NCI : IL6-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Parkinson disease
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : FCGR activation
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Nef and signal transduction
Reactome : Regulation of signaling by CBL
Reactome : Signaling by Interleukins
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
WikiPathway : Focal Adhesion
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-6 signaling pathway

Clone

Cloning Information : 247
HIP Master Clone ID : 87233
Original Clone ID : FLH000247.01L

Organism


TAX_ID : 9606
Species Specific ID: 3055

Genome

Chromosome : 20
Map Location : 20q11-q12
Ensembl : ENSG00000101336

Reagents

Labome : HCK-antibody