DNASU Plasmid Repository • 480.965.2857 | Email

NUP145 (Saccharomyces cerevisiae) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NUP145
Gene Name:  Nup145p
Sequence             
Original Clone ID: 15145a1BCt12p1
Keyword: None
Species: Saccharomyces cerevisiae
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: C-terminal 6-His, TOPO
Mutation/
Discrepancy :
No / No
Publications: PMID: 20310066
Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
Authors: PSI
New York SGX Research Center for Structural Genomics
ScCD00335173

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 516nts         Open reading frame : 1 to 516

AATAAACAAGACGGCGAAAATACTTTACAACATGAAAAGTCATCAAGTTTTGGTTATTGG
TGTTCTCCTTCCCCAGAACAGCTGGAGCGTTTGTCATTGAAGCAATTAGCGGCCGTTTCA
AATTTTGTTATCGGGAGAAGAGGTTATGGTTGTATTACATTTCAACATGATGTGGATCTC
ACAGCTTTTACCAAAAGCTTTAGAGAAGAACTATTCGGTAAAATTGTAATATTTCGTTCC
TCTAAGACAGTAGAAGTATATCCTGACGAAGCCACCAAACCAATGATTGGGCATGGGTTA
AACGTTCCCGCTATAATCACTCTAGAGAATGTTTATCCTGTAGATAAAAAAACAAAAAAA
CCGATGAAAGATACGACGAAGTTTGCTGAATTTCAAGTTTTTGACAGGAAACTAAGAAGC
ATGAGGGAAATGAACTATATATCCTATAATCCCTTTGGCGGGACTTGGACTTTCAAAGTC
AATCATTTTGAAGGGCATCATCACCATCACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-15145a
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NUP145
SYNONYM : RAT10
GENEID : 852788
Locus Tag : YGL092W
GI : 6321346
GenBank Accession : NM_001180957
Yeast Genome Database : S000003060
Target GenBank: None

 

Protein

PDB - Structural Annotation : 3KEP
PDB - Structural Annotation : 3KES
Structural Annotation Wiki : TOPSAN
UniProt : P49687
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 550896
HIP Master Clone ID : 461216
Original Clone ID : 15145a1BCt12p1

Experimental

Structural Biology Knowledgebase : SBKB (3KES)
Structural Biology Knowledgebase : SBKB (3KEP)
TargetTrack - Experimental data : NYSGXRC-15145a

Organism


TAX_ID : 559292
Species Specific ID: 852788

Genome

Chromosome : VII

Reagents

Labome : NUP145-cDNA