DNASU Plasmid Repository • 480.965.5697 | Email

ARHGEF1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARHGEF1
Gene Name:  Rho guanine nucleotide exchange factor (GEF) 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026512.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003365

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2562nts         Open reading frame : 1 to 2562
Reference Sequence Alignment

ATGGCCCTCCTGCAGCACGTGGCCCTGCAGTTTGAGCCAGGACCCCTGCTTTGCTGTCTG
CATGCCGACATGCTGGGCTCACTGGGCCCCAAGGAGGCCAAGAAGGCCTTCCTGGACTTC
TACCACAGCTTCCTGGAGAAGACAGCGGTTCTCCGGGTGCCGGTCCCTCCCAACGTCGCC
TTTGAACTTGACCGCACTAGGGCTGACCTCATCTCCGAGGATGTCCAGCGGCGGTTCGTG
CAGGAGGTGGTGCAAAGCCAGCAGGTAGCCGTGGGCCGGCAGCTGGAGGACTTCCGTTCC
AAGCGGCTCATGGGCATGACGCCCTGGGAGCAGGAGCTGGCCCAGCTGGAGGCTTGGGTT
GGGCGGGACCGAGCCAGCTACGAGGCCCGGGAGCGGCACGTGGCGGAGCGGCTGCTCATG
CACCTGGAGGAGATGCAACATACCATCTCTACCGACGAAGAAAAGAGTGCTGCCGTGGTC
AACGCCATTGGCCTGTACATGCGCCACCTTGGGGTGCGGACCAAGAGTGGAGACAAGAAG
TCGGGGAGGAACTTCTTCCGGAAAAAGGTGATGGGGAACCGGCGGTCGGACGAGCCTGCC
AAGACCAAGAAGGGGCTGAGCAGCATCCTGGATGCCGCCCGCTGGAACCGGGGAGAGCCC
CAGGTTCCAGATTTTCGACACCTCAAAGCAGAGGTTGATGCCGAGAAGCCAGGTGCTACA
GACCGGAAGGGAGGCGTGGGGATGCCCTCTCGGGACCGGAATATCGGGGCTCCTGGGCAG
GACACCCCTGGAGTCTCTCTGCACCCTCTGTCCCTGGACAGCCCAGACCGGGAACCAGGT
GCTGACGCCCCCCTGGAGCTGGGGGACTCATCCCCGCAGGGCCCAATGAGCCTGGAGTCC
TTGGCGCCCCCAGAGAGTACCGACGAGGGGGCCGAAACCGAGAGCCCCGAGCCTGGAGAT
GAGGGGGAGCCGGGGCGGTCGGGACTGGAGCTTGAACCAGAAGAGCCTCCCGGCTGGCGG
GAACTCGTCCCCCCAGACACCCTGCACAGCCTGCCCAAGAGCCAGGTGAAGCGGCAGGAG
GTCATCAGCGAGCTGCTGGTGACAGAGGCGGCCCACGTGCGCATGCTGCGGGTGCTGCAC
GACCTCTTCTTCCAGCCCATGGCAGAATGCCTGTTCTTCCCCTTGGAGGAGCTGCAGAAC
ATCTTCCCCAGCCTGGACGAGCTCATCGAGGTGCATTCCCTGTTCCTCGATCGCCTGATG
AAGCGGAGGCAGGAGAGTGGCTACCTCATCGAGGAGATCGGAGACGTGCTGCTGGCCCGG
TTTGATGGTGCTGAGGGCTCCTGGTTCCAGAAAATCTCCTCCCGCTTCTGCAGCCGCCAG
TCATTTGCCTTAGAGCAGCTCAAAGCCAAGCAACGCAAGGACCCTCGGTTCTGTGCCTTC
GTGCAGGAAGCTGAGAGCCGCCCGCGGTGCCGCCGCCTGCAGCTGAAGGACATGATCCCC
ACGGAGATGCAGCGGCTGACCAAGTACCCCCTGCTCCTGCAGAGCATCGGGCAGAACACA
GAAGAGCCCACAGAACGGGAGAAAGTGGAGCTGGCAGCCGAGTGCTGCCGGGAAATTCTA
CACCACGTCAACCAAGCCGTGCGTGACATGGAGGACCTGCTGAGGCTCAAGGACTATCAG
CGGCGCCTGGACTTGTCCCACCTTCGGCAGAGCAGCGACCCTATGCTGAGCGAGTTCAAG
AACCTGGACATCACCAAGAAGAAATTGGTCCACGAGGGCCCACTGACGTGGCGGGTGACT
AAGGACAAGGCAGTGGAGGTGCATGTGCTGCTGCTGGACGACCTGCTGCTGCTGCTCCAG
CGCCAGGACGAGCGGCTGCTGCTCAAGTCCCATAGCCGGACACTGACGCCCACGCCCGAT
GGCAAGACCATGCTGCGGCCCGTGCTGCGGCTCACCTCCGCCATGACCCGCGAGGTGGCC
ACCGATCACAAAGCCTTCTACGTCCTTTTTACCTGGGACCAGGAGGCCCAGATATACGAG
CTGGTGGCACAGACTGTGTCGGAGCGGAAAAACTGGTGTGCTCTCATCACTGAGACTGCC
GGATCCCTGAAAGTCCCTGCCCCTGCCTCTCGCCCTAAGCCCCGGCCCAGCCCGAGCAGC
ACCCGAGAACCCCTCCTCAGCAGCTCTGAGAACGGCAATGGTGGCCGAGAGACGTCTCCA
GCTGATGCCCGGACCGAGAGAATCCTCAGTGACCTCCTGCCCTTCTGCAGACCAGGCCCC
GAGGGCCAGCTCGCTGCCACGGCCCTTCGGAAAGTGCTGTCCCTGAAGCAGCTTCTGTTT
CCGGCGGAGGAAGACAATGGGGCGGGGCCTCCTCGAGATGGGGATGGGGTCCCAGGGGGC
GGCCCCCTGAGCCCAGCACGGACCCAGGAAATCCAGGAGAACCTGCTCAGCTTGGAGGAG
ACCATGAAGCAGCTGGAGGAGTTGGAGGAGGAATTTTGCCGCCTGAGACCCCTCCTGTCT
CAGCTTGGGGGGAACTCTGTCCCCCAGCCTGGCTGCACTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2595
Start on reference sequence 34
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARHGEF1
Symbol Nomenclature : ARHGEF1
SYNONYM : GEF1; LBCL2; LSC; P115-RHOGEF; SUB1.5
Designation : 115 kDa guanine nucleotide exchange factor|115-kD protein|Lsc homolog|p115RhoGEF|rho guanine nucleotide exchange factor 1
Full Nomenclature : Rho guanine nucleotide exchange factor (GEF) 1
GENEID : 9138
GI : 60652600
GenBank Accession : AY892078
HGNC : 681
MIM : 601855
Vega : OTTHUMG00000182679
Target GenBank: BC005155

 

Reference Sequence Alignment

  

HsCD00003365        ------------------------------------------------------------
NM_199002.1         ATGGCTTCTCTTTCCACCTGGAGCAGCCCTGCAGAGCCCAGGGAGATGGAAGACTTCGCC
NM_198977.1         ---------------------------------------------ATGGAAGACTTCGCC
XM_005259388.1      ---------------------------------------------ATGGAAGACTTCGCC
NM_004706.3         ---------------------------------------------ATGGAAGACTTCGCC
                                                                                

HsCD00003365        -------------------ATGGCCCTCCTGCAGCACGTGGCCCTGCAGTTTGAGCCAGG
NM_199002.1         CGAGGGGCGGCCTCCCCAGGCCCCTCCCGGCCTGGCCTGGTTCCCGTCAGCATCATCGGG
NM_198977.1         CGAGGGGCGGCCTCCCCAGGCCCCTCCCGGCCTGGCCTGGTTCCCGTCAGCATCATCGGG
XM_005259388.1      CGAGGGGCGGCCTCCCCAGGCCCCTCCCGGCCTGGCCTGGTTCCCGTCAGCATCATCGGG
NM_004706.3         CGAGGGGCGGCCTCCCCAGGCCCCTCCCGGCCTGGCCTGGTTCCCGTCAGCATCATCGGG
                                       .   * * *   *:* .*  *  ** * ..  : .. *.**

HsCD00003365        ACCCCTGCTTTGCTGTCTGCATGCCGACATGCTGGGCTCACTGGGCCCCAAGGAGGCCAA
NM_199002.1         GCTGAGGATGAGGATTTTGAGAACGAGCTGGAGACAAACTCAGAAGAGCAAAACAGCCAG
NM_198977.1         GCTGAGGATGAGGATTTTGAGAACGAGCTGGAGACAAACTCAGAAGAGCAAAACAGCCAG
XM_005259388.1      GCTGAGGATGAGGATTTTGAGAACGAGCTGGAGACAAACTCAGAAGAGCAAAACAGCCAG
NM_004706.3         GCTGAGGATGAGGATTTTGAGAACGAGCTGGAGACAAACTCAGAAGAGCAAAACAGCCAG
                    .*  . *.* :* : * **..:.* ..*: *. . ..:*:*:*.. . ***....****.

HsCD00003365        GAAGGCCTTCCTGGACTTCTACCACAGCTTCCTGGAGAAGACAGCG--------------
NM_199002.1         TTCCAGAGCCTGGAGCAGGTGAAGCGGCGCCCAGCCCACCTCATGGCCCTCCTGCAGCAC
NM_198977.1         TTCCAGAGCCTGGAGCAGGTGAAGCGGCGCCCAGCCCACCTCATGGCCCTCCTGCAGCAC
XM_005259388.1      TTCCAGAGCCTGGAGCAGGTGAAGCGGCGCCCAGCCCACCTCATGGCCCTCCTGCAGCAC
NM_004706.3         TTCCAGAGCCTGGAGCAGGTGAAGCGGCGCCCAGCCCACCTCATGGCCCTCCTGCAGCAC
                     :. . .  *  *..*:  *....*.**  **:* . *. :**  *              

HsCD00003365        ------------------------------------------------------------
NM_199002.1         GTGGCCCTGCAGTTTGAGCCAGGACCCCTGCTTTGCTGTCTGCATGCCGACATGCTGGGC
NM_198977.1         GTGGCCCTGCAGTTTGAGCCAGGACCCCT-------------------------------
XM_005259388.1      GTGGCCCTGCAGTTTGAGCCAGGACCCCTGCTTTGCTGTCTGCATGCCGACATGCTGGGC
NM_004706.3         GTGGCCCTGCAGTTTGAGCCAGGACCCCTGCTTTGCTGTCTGCATGCCGACATGCTGGGC
                                                                                

HsCD00003365        ------------------------------------------------------------
NM_199002.1         TCACTGGGCCCCAAGGAGGCCAAGAAGGCCTTCCTGGACTTCTACCACAGCTTCCTGGAG
NM_198977.1         ------------------------------------------------------------
XM_005259388.1      TCACTGGGCCCCAAGGAGGCCAAGAAGGCCTTCCTGGACTTCTACCACAGCTTCCTGGAG
NM_004706.3         TCACTGGGCCCCAAGGAGGCCAAGAAGGCCTTCCTGGACTTCTACCACAGCTTCCTGGAG
                                                                                

HsCD00003365        ---------GTTCTCCGGGTGCCGGTCCCTCCCAACGTCGCCTTTGAACTTGACCGCACT
NM_199002.1         AAGACAGCGGTTCTCCGGGTGCCGGTCCCTCCCAACGTCGCCTTTGAACTTGACCGCACT
NM_198977.1         --------GGTTCTCCGGGTGCCGGTCCCTCCCAACGTCGCCTTTGAACTTGACCGCACT
XM_005259388.1      AAGACAGCGGTTCTCCGGGTGCCGGTCCCTCCCAACGTCGCCTTTGAACTTGACCGCACT
NM_004706.3         AAGACAGCGGTTCTCCGGGTGCCGGTCCCTCCCAACGTCGCCTTTGAACTTGACCGCACT
                             ***************************************************

HsCD00003365        AGGGCTGACCTCATCTCCGAGGATGTCCAGCGGCGGTTCGTGCAGGAGGTGGTGCAAAGC
NM_199002.1         AGGGCTGACCTCATCTCCGAGGATGTCCAGCGGCGGTTCGTGCAGGAGGTGGTGCAAAGC
NM_198977.1         AGGGCTGACCTCATCTCCGAGGATGTCCAGCGGCGGTTCGTGCAGGAGGTGGTGCAAAGC
XM_005259388.1      AGGGCTGACCTCATCTCCGAGGATGTCCAGCGGCGGTTCGTGCAGGAGGTGGTGCAAAGC
NM_004706.3         AGGGCTGACCTCATCTCCGAGGATGTCCAGCGGCGGTTCGTGCAGGAGGTGGTGCAAAGC
                    ************************************************************

HsCD00003365        CAGCAGGTAGCCGTGGGCCGGCAGCTGGAGGACTTCCGTTCCAAGCGGCTCATGGGCATG
NM_199002.1         CAGCAGGTAGCCGTGGGCCGGCAGCTGGAGGACTTCCGTTCCAAGCGGCTCATGGGCATG
NM_198977.1         CAGCAGGTAGCCGTGGGCCGGCAGCTGGAGGACTTCCGTTCCAAGCGGCTCATGGGCATG
XM_005259388.1      CAGCAGGTAGCCGTGGGCCGGCAGCTGGAGGACTTCCGTTCCAAGCGGCTCATGGGCATG
NM_004706.3         CAGCAGGTAGCCGTGGGCCGGCAGCTGGAGGACTTCCGTTCCAAGCGGCTCATGGGCATG
                    ************************************************************

HsCD00003365        ACGCCCTGGGAGCAGGAGCTGGCCCAGCTGGAGGCTTGGGTTGGGCGGGACCGAGCCAGC
NM_199002.1         ACGCCCTGGGAGCAGGAGCTGGCCCAGCTGGAGGCTTGGGTTGGGCGGGACCGAGCCAGC
NM_198977.1         ACGCCCTGGGAGCAGGAGCTGGCCCAGCTGGAGGCTTGGGTTGGGCGGGACCGAGCCAGC
XM_005259388.1      ACGCCCTGGGAGCAGGAGCTGGCCCAGCTGGAGGCTTGGGTTGGGCGGGACCGAGCCAGC
NM_004706.3         ACGCCCTGGGAGCAGGAGCTGGCCCAGCTGGAGGCTTGGGTTGGGCGGGACCGAGCCAGC
                    ************************************************************

HsCD00003365        TACGAGGCCCGGGAGCGGCACGTGGCGGAGCGGCTGCTCATGCACCTGGAGGAGATGCAA
NM_199002.1         TACGAGGCCCGGGAGCGGCACGTGGCGGAGCGGCTGCTCATGCACCTGGAGGAGATGCAA
NM_198977.1         TACGAGGCCCGGGAGCGGCACGTGGCGGAGCGGCTGCTCATGCACCTGGAGGAGATGCAA
XM_005259388.1      TACGAGGCCCGGGAGCGGCACGTGGCGGAGCGGCTGCTCATGCACCTGGAGGAGATGCAA
NM_004706.3         TACGAGGCCCGGGAGCGGCACGTGGCGGAGCGGCTGCTCATGCACCTGGAGGAGATGCAA
                    ************************************************************

HsCD00003365        CATACCATCTCTACCGACGAAGAAAAGAGTGCTGCCGTGGTCAACGCCATTGGCCTGTAC
NM_199002.1         CATACCATCTCTACCGACGAAGAAAAGAGTGCTGCCGTGGTCAACGCCATTGGCCTGTAC
NM_198977.1         CATACCATCTCTACCGACGAAGAAAAGAGTGCTGCCGTGGTCAACGCCATTGGCCTGTAC
XM_005259388.1      CATACCATCTCTACCGACGAAGAAAAGAGTGCTGCCGTGGTCAACGCCATTGGCCTGTAC
NM_004706.3         CATACCATCTCTACCGACGAAGAAAAGAGTGCTGCCGTGGTCAACGCCATTGGCCTGTAC
                    ************************************************************

HsCD00003365        ATGCGCCACCTTGGGGTGCGGACCAAGAGTGGAGACAAGAAGTCGGGGAGGAACTTCTTC
NM_199002.1         ATGCGCCACCTTGGGGTGCGGACCAAGAGTGGAGACAAGAAGTCGGGGAGGAACTTCTTC
NM_198977.1         ATGCGCCACCTTGGGGTGCGGACCAAGAGTGGAGACAAGAAGTCGGGGAGGAACTTCTTC
XM_005259388.1      ATGCGCCACCTTGGGGTGCGGACCAAGAGTGGAGACAAGAAGTCGGGGAGGAACTTCTTC
NM_004706.3         ATGCGCCACCTTGGGGTGCGGACCAAGAGTGGAGACAAGAAGTCGGGGAGGAACTTCTTC
                    ************************************************************

HsCD00003365        CGGAAAAAGGTGATGGGGAACCGGCGGTCGGACGAGCCTGCCAAGACCAAGAAGGGGCTG
NM_199002.1         CGGAAAAAGGTGATGGGGAACCGGCGGTCGGACGAGCCTGCCAAGACCAAGAAGGGGCTG
NM_198977.1         CGGAAAAAGGTGATGGGGAACCGGCGGTCGGACGAGCCTGCCAAGACCAAGAAGGGGCTG
XM_005259388.1      CGGAAAAAGGTGATGGGGAACCGGCGGTCGGACGAGCCTGCCAAGACCAAGAAGGGGCTG
NM_004706.3         CGGAAAAAGGTGATGGGGAACCGGCGGTCGGACGAGCCTGCCAAGACCAAGAAGGGGCTG
                    ************************************************************

HsCD00003365        AGCAGCATCCTGGATGCCGCCCGCTGGAACCGGGGAGAGCCCCAGGTTCCAGATTTTCGA
NM_199002.1         AGCAGCATCCTGGATGCCGCCCGCTGGAACCGGGGAGAGCCCCAGGTTCCAGATTTTCGA
NM_198977.1         AGCAGCATCCTGGATGCCGCCCGCTGGAACCGGGGAGAGCCCCAGGTTCCAGATTTTCGA
XM_005259388.1      AGCAGCATCCTGGATGCCGCCCGCTGGAACCGGGGAGAGCCCCAGGTTCCAGATTTTCGA
NM_004706.3         AGCAGCATCCTGGATGCCGCCCGCTGGAACCGGGGAGAGCCCCAGGTTCCAGATTTTCGA
                    ************************************************************

HsCD00003365        CACCTCAAAGCAGAGGTTGATGCCGAGAAGCCAGGTGCTACAGACCGGAAGGGAGGCGTG
NM_199002.1         CACCTCAAAGCAGAGGTTGATGCCGAGAAGCCAGGTGCTACAGACCGGAAGGGAGGCGTG
NM_198977.1         CACCTCAAAGCAGAGGTTGATGCCGAGAAGCCAGGTGCTACAGACCGGAAGGGAGGCGTG
XM_005259388.1      CACCTCAAAGCAGAGGTTGATGCCGAGAAGCCAGGTGCTACAGACCGGAAGGGAGGCGTG
NM_004706.3         CACCTCAAAGCAGAGGTTGATGCCGAGAAGCCAGGTGCTACAGACCGGAAGGGAGGCGTG
                    ************************************************************

HsCD00003365        GGGATGCCCTCTCGGGACCGGAATATCGGGGCTCCTGGGCAGGACACCCCTGGAGTCTCT
NM_199002.1         GGGATGCCCTCTCGGGACCGGAATATCGGGGCTCCTGGGCAGGACACCCCTGGAGTCTCT
NM_198977.1         GGGATGCCCTCTCGGGACCGGAATATCGGGGCTCCTGGGCAGGACACCCCTGGAGTCTCT
XM_005259388.1      GGGATGCCCTCTCGGGACCGGAATATCGGGGCTCCTGGGCAGGACACCCCTGGAGTCTCT
NM_004706.3         GGGATGCCCTCTCGGGACCGGAATATCGGGGCTCCTGGGCAGGACACCCCTGGAGTCTCT
                    ************************************************************

HsCD00003365        CTGCACCCTCTGTCCCTGGACAGCCCAGACCGGGAACCAGGTGCTGACGCCCCCCTGGAG
NM_199002.1         CTGCACCCTCTGTCCCTGGACAGCCCAGACCGGGAACCAGGTGCTGACGCCCCCCTGGAG
NM_198977.1         CTGCACCCTCTGTCCCTGGACAGCCCAGACCGGGAACCAGGTGCTGACGCCCCCCTGGAG
XM_005259388.1      CTGCACCCTCTGTCCCTGGACAGCCCAGACCGGGAACCAGGTGCTGACGCCCCCCTGGAG
NM_004706.3         CTGCACCCTCTGTCCCTGGACAGCCCAGACCGGGAACCAGGTGCTGACGCCCCCCTGGAG
                    ************************************************************

HsCD00003365        CTGGGGGACTCATCCCCGCAGGGCCCAATGAGCCTGGAGTCCTTGGCGCCCCCAGAGAGT
NM_199002.1         CTGGGGGACTCATCCCCGCAGGGCCCAATGAGCCTGGAGTCCTTGGCGCCCCCAGAGAGT
NM_198977.1         CTGGGGGACTCATCCCCGCAGGGCCCAATGAGCCTGGAGTCCTTGGCGCCCCCAGAGAGT
XM_005259388.1      CTGGGGGACTCATCCCCGCAGGGCCCAATGAGCCTGGAGTCCTTGGCGCCCCCAGAGAGT
NM_004706.3         CTGGGGGACTCATCCCCGCAGGGCCCAATGAGCCTGGAGTCCTTGGCGCCCCCAGAGAGT
                    ************************************************************

HsCD00003365        ACCGACGAGGGGGCCGAAACCGAGAGCCCCG-----------------------------
NM_199002.1         ACCGACGAGGGGGCCGAAACCGAGAGCCCCG-----------------------------
NM_198977.1         ACCGACGAGGGGGCCGAAACCGAGAGCCCCG-----------------------------
XM_005259388.1      ACCGACGAGGGGGCCGAAACCGAGAGAAGGTGGAAGAGGCTATCAGGGCGTCTGGGGCGC
NM_004706.3         ACCGACGAGGGGGCCGAAACCGAGAGCCCCG-----------------------------
                    **************************..                                

HsCD00003365        ------------------------------------------------------------
NM_199002.1         ------------------------------------------------------------
NM_198977.1         ------------------------------------------------------------
XM_005259388.1      TCAGAGAGCCTGCGGGTGAGTGACCGCCGCCGGCCTTCCCGGGGCAGCCTCGGGGCTAAG
NM_004706.3         ------------------------------------------------------------
                                                                                

HsCD00003365        ------------------------------------------------------------
NM_199002.1         ------------------------------------------------------------
NM_198977.1         ------------------------------------------------------------
XM_005259388.1      GGCCGGGGTGGGGGCCGCTCCCGGAGCGACGTGGACATGGACCCCAGTTCCGCCACGGCA
NM_004706.3         ------------------------------------------------------------
                                                                                

HsCD00003365        -------------------------------AGCCTGGAGATGAGGGGGAGCCGGGGCGG
NM_199002.1         -------------------------------AGCCTGGAGATGAGGGGGAGCCGGGGCGG
NM_198977.1         -------------------------------AGCCTGGAGATGAGGGGGAGCCGGGGCGG
XM_005259388.1      GTGCTTGGCCCTGCCCGACGAGCCACCCCCGAGCCTGGAGATGAGGGGGAGCCGGGGCGG
NM_004706.3         -------------------------------AGCCTGGAGATGAGGGGGAGCCGGGGCGG
                                                   *****************************

HsCD00003365        TCGGGACTGGAGCTTGAACCAGAAGAGCCTCCCGGCTGGCGGGAACTCGTCCCCCCAGAC
NM_199002.1         TCGGGACTGGAGCTTGAACCAGAAGAGCCTCCCGGCTGGCGGGAACTCGTCCCCCCAGAC
NM_198977.1         TCGGGACTGGAGCTTGAACCAGAAGAGCCTCCCGGCTGGCGGGAACTCGTCCCCCCAGAC
XM_005259388.1      TCGGGACTGGAGCTTGAACCAGAAGAGCCTCCCGGCTGGCGGGAACTCGTCCCCCCAGAC
NM_004706.3         TCGGGACTGGAGCTTGAACCAGAAGAGCCTCCCGGCTGGCGGGAACTCGTCCCCCCAGAC
                    ************************************************************

HsCD00003365        ACCCTGCACAGCCTGCCCAAGAGCCAGGTGAAGCGGCAGGAGGTCATCAGCGAGCTGCTG
NM_199002.1         ACCCTGCACAGCCTGCCCAAGAGCCAGGTGAAGCGGCAGGAGGTCATCAGCGAGCTGCTG
NM_198977.1         ACCCTGCACAGCCTGCCCAAGAGCCAGGTGAAGCGGCAGGAGGTCATCAGCGAGCTGCTG
XM_005259388.1      ACCCTGCACAGCCTGCCCAAGAGCCAGGTGAAGCGGCAGGAGGTCATCAGCGAGCTGCTG
NM_004706.3         ACCCTGCACAGCCTGCCCAAGAGCCAGGTGAAGCGGCAGGAGGTCATCAGCGAGCTGCTG
                    ************************************************************

HsCD00003365        GTGACAGAGGCGGCCCACGTGCGCATGCTGCGGGTGCTGCACGACCTCTTCTTCCAGCCC
NM_199002.1         GTGACAGAGGCGGCCCACGTGCGCATGCTGCGGGTGCTGCACGACCTCTTCTTCCAGCCC
NM_198977.1         GTGACAGAGGCGGCCCACGTGCGCATGCTGCGGGTGCTGCACGACCTCTTCTTCCAGCCC
XM_005259388.1      GTGACAGAGGCGGCCCACGTGCGCATGCTGCGGGTGCTGCACGACCTCTTCTTCCAGCCC
NM_004706.3         GTGACAGAGGCGGCCCACGTGCGCATGCTGCGGGTGCTGCACGACCTCTTCTTCCAGCCC
                    ************************************************************

HsCD00003365        ATGGCAGAATGCCTGTTCTTCCCCTTGGAGGAGCTGCAGAACATCTTCCCCAGCCTGGAC
NM_199002.1         ATGGCAGAATGCCTGTTCTTCCCCTTGGAGGAGCTGCAGAACATCTTCCCCAGCCTGGAC
NM_198977.1         ATGGCAGAATGCCTGTTCTTCCCCTTGGAGGAGCTGCAGAACATCTTCCCCAGCCTGGAC
XM_005259388.1      ATGGCAGAATGCCTGTTCTTCCCCTTGGAGGAGCTGCAGAACATCTTCCCCAGCCTGGAC
NM_004706.3         ATGGCAGAATGCCTGTTCTTCCCCTTGGAGGAGCTGCAGAACATCTTCCCCAGCCTGGAC
                    ************************************************************

HsCD00003365        GAGCTCATCGAGGTGCATTCCCTGTTCCTCGATCGCCTGATGAAGCGGAGGCAGGAGAGT
NM_199002.1         GAGCTCATCGAGGTGCATTCCCTGTTCCTCGATCGCCTGATGAAGCGGAGGCAGGAGAGT
NM_198977.1         GAGCTCATCGAGGTGCATTCCCTGTTCCTCGATCGCCTGATGAAGCGGAGGCAGGAGAGT
XM_005259388.1      GAGCTCATCGAGGTGCATTCCCTGTTCCTCGATCGCCTGATGAAGCGGAGGCAGGAGAGT
NM_004706.3         GAGCTCATCGAGGTGCATTCCCTGTTCCTCGATCGCCTGATGAAGCGGAGGCAGGAGAGT
                    ************************************************************

HsCD00003365        GGCTACCTCATCGAGGAGATCGGAGACGTGCTGCTGGCCCGGTTTGATGGTGCTGAGGGC
NM_199002.1         GGCTACCTCATCGAGGAGATCGGAGACGTGCTGCTGGCCCGGTTTGATGGTGCTGAGGGC
NM_198977.1         GGCTACCTCATCGAGGAGATCGGAGACGTGCTGCTGGCCCGGTTTGATGGTGCTGAGGGC
XM_005259388.1      GGCTACCTCATCGAGGAGATCGGAGACGTGCTGCTGGCCCGGTTTGATGGTGCTGAGGGC
NM_004706.3         GGCTACCTCATCGAGGAGATCGGAGACGTGCTGCTGGCCCGGTTTGATGGTGCTGAGGGC
                    ************************************************************

HsCD00003365        TCCTGGTTCCAGAAAATCTCCTCCCGCTTCTGCAGCCGCCAGTCATTTGCCTTAGAGCAG
NM_199002.1         TCCTGGTTCCAGAAAATCTCCTCCCGCTTCTGCAGCCGCCAGTCATTTGCCTTAGAGCAG
NM_198977.1         TCCTGGTTCCAGAAAATCTCCTCCCGCTTCTGCAGCCGCCAGTCATTTGCCTTAGAGCAG
XM_005259388.1      TCCTGGTTCCAGAAAATCTCCTCCCGCTTCTGCAGCCGCCAGTCATTTGCCTTAGAGCAG
NM_004706.3         TCCTGGTTCCAGAAAATCTCCTCCCGCTTCTGCAGCCGCCAGTCATTTGCCTTAGAGCAG
                    ************************************************************

HsCD00003365        CTCAAAGCCAAGCAACGCAAGGACCCTCGGTTCTGTGCCTTCGTGCAGGAAGCTGAGAGC
NM_199002.1         CTCAAAGCCAAGCAACGCAAGGACCCTCGGTTCTGTGCCTTCGTGCAGGAAGCTGAGAGC
NM_198977.1         CTCAAAGCCAAGCAACGCAAGGACCCTCGGTTCTGTGCCTTCGTGCAGGAAGCTGAGAGC
XM_005259388.1      CTCAAAGCCAAGCAACGCAAGGACCCTCGGTTCTGTGCCTTCGTGCAGGAAGCTGAGAGC
NM_004706.3         CTCAAAGCCAAGCAACGCAAGGACCCTCGGTTCTGTGCCTTCGTGCAGGAAGCTGAGAGC
                    ************************************************************

HsCD00003365        CGCCCGCGGTGCCGCCGCCTGCAGCTGAAGGACATGATCCCCACGGAGATGCAGCGGCTG
NM_199002.1         CGCCCGCGGTGCCGCCGCCTGCAGCTGAAGGACATGATCCCCACGGAGATGCAGCGGCTG
NM_198977.1         CGCCCGCGGTGCCGCCGCCTGCAGCTGAAGGACATGATCCCCACGGAGATGCAGCGGCTG
XM_005259388.1      CGCCCGCGGTGCCGCCGCCTGCAGCTGAAGGACATGATCCCCACGGAGATGCAGCGGCTG
NM_004706.3         CGCCCGCGGTGCCGCCGCCTGCAGCTGAAGGACATGATCCCCACGGAGATGCAGCGGCTG
                    ************************************************************

HsCD00003365        ACCAAGTACCCCCTGCTCCTGCAGAGCATCGGGCAGAACACAGAAGAGCCCACAGAACGG
NM_199002.1         ACCAAGTACCCCCTGCTCCTGCAGAGCATCGGGCAGAACACAGAAGAGCCCACAGAACGG
NM_198977.1         ACCAAGTACCCCCTGCTCCTGCAGAGCATCGGGCAGAACACAGAAGAGCCCACAGAACGG
XM_005259388.1      ACCAAGTACCCCCTGCTCCTGCAGAGCATCGGGCAGAACACAGAAGAGCCCACAGAACGG
NM_004706.3         ACCAAGTACCCCCTGCTCCTGCAGAGCATCGGGCAGAACACAGAAGAGCCCACAGAACGG
                    ************************************************************

HsCD00003365        GAGAAAGTGGAGCTGGCAGCCGAGTGCTGCCGGGAAATTCTACACCACGTCAACCAAGCC
NM_199002.1         GAGAAAGTGGAGCTGGCAGCCGAGTGCTGCCGGGAAATTCTACACCACGTCAACCAAGCC
NM_198977.1         GAGAAAGTGGAGCTGGCAGCCGAGTGCTGCCGGGAAATTCTACACCACGTCAACCAAGCC
XM_005259388.1      GAGAAAGTGGAGCTGGCAGCCGAGTGCTGCCGGGAAATTCTACACCACGTCAACCAAGCC
NM_004706.3         GAGAAAGTGGAGCTGGCAGCCGAGTGCTGCCGGGAAATTCTACACCACGTCAACCAAGCC
                    ************************************************************

HsCD00003365        GTGCGTGACATGGAGGACCTGCTGAGGCTCAAGGACTATCAGCGGCGCCTGGACTTGTCC
NM_199002.1         GTGCGTGACATGGAGGACCTGCTGAGGCTCAAGGACTATCAGCGGCGCCTGGACTTGTCC
NM_198977.1         GTGCGTGACATGGAGGACCTGCTGAGGCTCAAGGACTATCAGCGGCGCCTGGACTTGTCC
XM_005259388.1      GTGCGTGACATGGAGGACCTGCTGAGGCTCAAGGACTATCAGCGGCGCCTGGACTTGTCC
NM_004706.3         GTGCGTGACATGGAGGACCTGCTGAGGCTCAAGGACTATCAGCGGCGCCTGGACTTGTCC
                    ************************************************************

HsCD00003365        CACCTTCGGCAGAGCAGCGACCCTATGCTGAGCGAGTTCAAGAACCTGGACATCACCAAG
NM_199002.1         CACCTTCGGCAGAGCAGCGACCCTATGCTGAGCGAGTTCAAGAACCTGGACATCACCAAG
NM_198977.1         CACCTTCGGCAGAGCAGCGACCCTATGCTGAGCGAGTTCAAGAACCTGGACATCACCAAG
XM_005259388.1      CACCTTCGGCAGAGCAGCGACCCTATGCTGAGCGAGTTCAAGAACCTGGACATCACCAAG
NM_004706.3         CACCTTCGGCAGAGCAGCGACCCTATGCTGAGCGAGTTCAAGAACCTGGACATCACCAAG
                    ************************************************************

HsCD00003365        AAGAAATTGGTCCACGAGGGCCCACTGACGTGGCGGGTGACTAAGGACAAGGCAGTGGAG
NM_199002.1         AAGAAATTGGTCCACGAGGGCCCACTGACGTGGCGGGTGACTAAGGACAAGGCAGTGGAG
NM_198977.1         AAGAAATTGGTCCACGAGGGCCCACTGACGTGGCGGGTGACTAAGGACAAGGCAGTGGAG
XM_005259388.1      AAGAAATTGGTCCACGAGGGCCCACTGACGTGGCGGGTGACTAAGGACAAGGCAGTGGAG
NM_004706.3         AAGAAATTGGTCCACGAGGGCCCACTGACGTGGCGGGTGACTAAGGACAAGGCAGTGGAG
                    ************************************************************

HsCD00003365        GTGCATGTGCTGCTGCTGGACGACCTGCTGCTGCTGCTCCAGCGCCAGGACGAGCGGCTG
NM_199002.1         GTGCATGTGCTGCTGCTGGACGACCTGCTGCTGCTGCTCCAGCGCCAGGACGAGCGGCTG
NM_198977.1         GTGCATGTGCTGCTGCTGGACGACCTGCTGCTGCTGCTCCAGCGCCAGGACGAGCGGCTG
XM_005259388.1      GTGCATGTGCTGCTGCTGGACGACCTGCTGCTGCTGCTCCAGCGCCAGGACGAGCGGCTG
NM_004706.3         GTGCATGTGCTGCTGCTGGACGACCTGCTGCTGCTGCTCCAGCGCCAGGACGAGCGGCTG
                    ************************************************************

HsCD00003365        CTGCTCAAGTCCCATAGCCGGACACTGACGCCCACGCCCGATGGCAAGACCATGCTGCGG
NM_199002.1         CTGCTCAAGTCCCATAGCCGGACACTGACGCCCACGCCCGATGGCAAGACCATGCTGCGG
NM_198977.1         CTGCTCAAGTCCCATAGCCGGACACTGACGCCCACGCCCGATGGCAAGACCATGCTGCGG
XM_005259388.1      CTGCTCAAGTCCCATAGCCGGACACTGACGCCCACGCCCGATGGCAAGACCATGCTGCGG
NM_004706.3         CTGCTCAAGTCCCATAGCCGGACACTGACGCCCACGCCCGATGGCAAGACCATGCTGCGG
                    ************************************************************

HsCD00003365        CCCGTGCTGCGGCTCACCTCCGCCATGACCCGCGAGGTGGCCACCGATCACAAAGCCTTC
NM_199002.1         CCCGTGCTGCGGCTCACCTCCGCCATGACCCGCGAGGTGGCCACCGATCACAAAGCCTTC
NM_198977.1         CCCGTGCTGCGGCTCACCTCCGCCATGACCCGCGAGGTGGCCACCGATCACAAAGCCTTC
XM_005259388.1      CCCGTGCTGCGGCTCACCTCCGCCATGACCCGCGAGGTGGCCACCGATCACAAAGCCTTC
NM_004706.3         CCCGTGCTGCGGCTCACCTCCGCCATGACCCGCGAGGTGGCCACCGATCACAAAGCCTTC
                    ************************************************************

HsCD00003365        TACGTCCTTTTTACCTGGGACCAGGAGGCCCAGATATACGAGCTGGTGGCACAGACTGTG
NM_199002.1         TACGTCCTTTTTACCTGGGACCAGGAGGCCCAGATATACGAGCTGGTGGCACAGACTGTG
NM_198977.1         TACGTCCTTTTTACCTGGGACCAGGAGGCCCAGATATACGAGCTGGTGGCACAGACTGTG
XM_005259388.1      TACGTCCTTTTTACCTGGGACCAGGAGGCCCAGATATACGAGCTGGTGGCACAGACTGTG
NM_004706.3         TACGTCCTTTTTACCTGGGACCAGGAGGCCCAGATATACGAGCTGGTGGCACAGACTGTG
                    ************************************************************

HsCD00003365        TCGGAGCGGAAAAACTGGTGTGCTCTCATCACTGAGACTGCCGGATCCCTGAAAGTCCCT
NM_199002.1         TCGGAGCGGAAAAACTGGTGTGCTCTCATCACTGAGACTGCCGGATCCCTGAAAGTCCCT
NM_198977.1         TCGGAGCGGAAAAACTGGTGTGCTCTCATCACTGAGACTGCCGGATCCCTGAAAGTCCCT
XM_005259388.1      TCGGAGCGGAAAAACTGGTGTGCTCTCATCACTGAGACTGCCGGATCCCTGAAAGTCCCT
NM_004706.3         TCGGAGCGGAAAAACTGGTGTGCTCTCATCACTGAGACTGCCGGATCCCTGAAAGTCCCT
                    ************************************************************

HsCD00003365        GCCCCTGCCTCTCGCCCTAAGCCCCGGCCCAGCCCGAGCAGCACCCGAGAACCCCTCCTC
NM_199002.1         GCCCCTGCCTCTCGCCCTAAGCCCCGGCCCAGCCCGAGCAGCACCCGAGAACCCCTCCTC
NM_198977.1         GCCCCTGCCTCTCGCCCTAAGCCCCGGCCCAGCCCGAGCAGCACCCGAGAACCCCTCCTC
XM_005259388.1      GCCCCTGCCTCTCGCCCTAAGCCCCGGCCCAGCCCGAGCAGCACCCGAGAACCCCTCCTC
NM_004706.3         GCCCCTGCCTCTCGCCCTAAGCCCCGGCCCAGCCCGAGCAGCACCCGAGAACCCCTCCTC
                    ************************************************************

HsCD00003365        AGCAGCTCTGAGAACGGCAATGGTGGCCGAGAGACGTCTCCAGCTGATGCCCGGACCGAG
NM_199002.1         AGCAGCTCTGAGAACGGCAATGGTGGCCGAGAGACGTCTCCAGCTGATGCCCGGACCGAG
NM_198977.1         AGCAGCTCTGAGAACGGCAATGGTGGCCGAGAGACGTCTCCAGCTGATGCCCGGACCGAG
XM_005259388.1      AGCAGCTCTGAGAACGGCAATGGTGGCCGAGAGACGTCTCCAGCTGATGCCCGGACCGAG
NM_004706.3         AGCAGCTCTGAGAACGGCAATGGTGGCCGAGAGACGTCTCCAGCTGATGCCCGGACCGAG
                    ************************************************************

HsCD00003365        AGAATCCTCAGTGACCTCCTGCCCTTCTGCAGACCAGGCCCCGAGGGCCAGCTCGCTGCC
NM_199002.1         AGAATCCTCAGTGACCTCCTGCCCTTCTGCAGACCAGGCCCCGAGGGCCAGCTCGCTGCC
NM_198977.1         AGAATCCTCAGTGACCTCCTGCCCTTCTGCAGACCAGGCCCCGAGGGCCAGCTCGCTGCC
XM_005259388.1      AGAATCCTCAGTGACCTCCTGCCCTTCTGCAGACCAGGCCCCGAGGGCCAGCTCGCTGCC
NM_004706.3         AGAATCCTCAGTGACCTCCTGCCCTTCTGCAGACCAGGCCCCGAGGGCCAGCTCGCTGCC
                    ************************************************************

HsCD00003365        ACGGCCCTTCGGAAAGTG------------------------------------------
NM_199002.1         ACGGCCCTTCGGAAAGTG------------------------------------------
NM_198977.1         ACGGCCCTTCGGAAAGTG------------------------------------------
XM_005259388.1      ACGGCCCTTCGGAAAGGAGTTGGAGGAGGAATTTTGCCGCCTGAGACCCCTCCTGTCTCA
NM_004706.3         ACGGCCCTTCGGAAAGTG------------------------------------------
                    **************** .                                          

HsCD00003365        ---------------------CTGTCCCTGAAGCAGCTTCTGTTTCCGGCGGAGGAAGAC
NM_199002.1         ---------------------CTGTCCCTGAAGCAGCTTCTGTTTCCGGCGGAGGAAGAC
NM_198977.1         ---------------------CTGTCCCTGAAGCAGCTTCTGTTTCCGGCGGAGGAAGAC
XM_005259388.1      GCTTGGGGGGAACTCTGTCCCCCAGCCTGGCTGCACTTGAGGTTCCCGCCCAGGAAGGCC
NM_004706.3         ---------------------CTGTCCCTGAAGCAGCTTCTGTTTCCGGCGGAGGAAGAC
                                         * . **  *.:***  * . *** *** * ..*.*.*.*

HsCD00003365        AATGGGGCGGGGCCTCCTCGAGATGGGGATGGGGTCCCAGGGGGCGGCCCCCTGAGCCCA
NM_199002.1         AATGGGGCGGGGCCTCCTCGAGATGGGGATGGGGTCCCAGGGGGCGGCCCCCTGAGCCCA
NM_198977.1         AATGGGGCGGGGCCTCCTCGAGATGGGGATGGGGTCCCAGGGGGCGGCCCCCTGAGCCCA
XM_005259388.1      TTTTGCAAGAAGGAGAGGAATGGGGGAGAGGACGTGAGGGACCACCCCCACCCACACAGC
NM_004706.3         AATGGGGCGGGGCCTCCTCGAGATGGGGATGGGGTCCCAGGGGGCGGCCCCCTGAGCCCA
                    ::* * ..*..* . .  ..:*. **.** *. ** . .*.  .*  **.** ...*. .

HsCD00003365        GCACGGACCCAGGAAATCCAGGAGAACCTGCTCAGCTTGGAGGAGACCATGAAGCAGCTG
NM_199002.1         GCACGGACCCAGGAAATCCAGGAGAACCTGCTCAGCTTGGAGGAGACCATGAAGCAGCTG
NM_198977.1         GCACGGACCCAGGAAATCCAGGAGAACCTGCTCAGCTTGGAGGAGACCATGAAGCAGCTG
XM_005259388.1      TGCCGCAGCATCTCACACCCCGAGGGCCTGAGGAGAGGGAGCTGTGGGCCACGCCTGGGA
NM_004706.3         GCACGGACCCAGGAAATCCAGGAGAACCTGCTCAGCTTGGAGGAGACCATGAAGCAGCTG
                      .** * *.:  .*.:**. ***..****.  **.  *..  . .  . ... *:*  .

HsCD00003365        GAGGAGTTGGAGGAGGAATTTTGCCGCCTGAGACCCCTCCTGTCTCAGCTTGGGGGGAAC
NM_199002.1         GAGGAGTTGGAGGAGGAATTTTGCCGCCTGAGACCCCTCCTGTCTCAGCTTGGGGGGAAC
NM_198977.1         GAGGAGTTGGAGGAGGAATTTTGCCGCCTGAGACCCCTCCTGTCTCAGCTTGGGGGGAAC
XM_005259388.1      GGGGCCCAGCTGGGGTTACTGGCCCCGCATGAGCCTCGGCCATCTCTCCCTCCTGCCCTC
NM_004706.3         GAGGAGTTGGAGGAGGAATTTTGCCGCCTGAGACCCCTCCTGTCTCAGCTTGGGGGGAAC
                    *.**.  :* :**.* :* *   **  *: ...** *  * .****: * *   *  .:*

HsCD00003365        TCTGTCCCCCAGCCTGGCTGCACTTTG---------------------------------
NM_199002.1         TCTGTCCCCCAGCCTGGCTGCACTTGA---------------------------------
NM_198977.1         TCTGTCCCCCAGCCTGGCTGCACTTGA---------------------------------
XM_005259388.1      TGCTTGGGGGACTCAGGGCTCCATTCTGGAGGGCACCACGGTGACCCGGGCCATCTCAGT
NM_004706.3         TCTGTCCCCCAGCCTGGCTGCACTTGA---------------------------------
                    *   *     *  *:**   *..**                                   

HsCD00003365        ------------------------------------------------------------
NM_199002.1         ------------------------------------------------------------
NM_198977.1         ------------------------------------------------------------
XM_005259388.1      ATTGCCTGTGGGGGCCACCCCTCCACCCCCACCCCCAAGTGCCTTCGCTCTGTTTTTATA
NM_004706.3         ------------------------------------------------------------
                                                                                

HsCD00003365        ------
NM_199002.1         ------
NM_198977.1         ------
XM_005259388.1      CCCTGA
NM_004706.3         ------
                          

Pathways

NCI : LPA receptor mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : Regulation of RhoA activity
NCI : Thromboxane A2 receptor signaling
Panther : Axon guidance mediated by semaphorins
Panther : Cytoskeletal regulation by Rho GTPase
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Reactome : Axonal growth inhibition (RHOA activation)
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR regulates axonogenesis
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : G13 Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 26512
HIP Master Clone ID : 56888
Original Clone ID : FLH026512.01L

Organism


TAX_ID : 9606
Species Specific ID: 9138

Genome

Chromosome : 19
Map Location : 19q13.13
Ensembl : ENSG00000076928

Reagents

Labome : ARHGEF1-antibody