DNASU Plasmid Repository • 480.965.5697 | Email

MRE11A (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MRE11A
Gene Name:  MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Sequence             
Original Clone ID: 8658a8BCt5p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: C-terminal 6-His, TOPO
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00336657

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1071nts         Open reading frame : 1 to 1071
Reference Sequence Alignment

AGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGATATT
CATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTCGAT
GAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGATCTT
TTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGAAAA
TATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAACTTT
GGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATTCCA
GTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCCTTG
GACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAG
ATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTA
GGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTG
AGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGGAGT
AAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTTGTT
ATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTGTTT
TATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTAAAG
AAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCTCTT
CACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATTTTT
AACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATTGAA
GAAATGCTTGAAAATGCTGAACGGGAAGGGCATCATCACCATCACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Tested_Not_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8658a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MRE11A
Symbol Nomenclature : MRE11A
SYNONYM : ATLD; HNGS1; MRE11; MRE11B
Designation : AT-like disease|DNA recombination and repair protein|MRE11 homolog 1|MRE11 homolog A|double-strand break repair protein MRE11A|endo/exonuclease Mre11|meiotic recombination 11 homolog 1|meiotic recombination 11 homolog A
Full Nomenclature : MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
GENEID : 4361
GI : 24234690
GenBank Accession : NM_005590
HGNC : 7230
MIM : 600814
Vega : OTTHUMG00000167780
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------ATGTCTGTGGAG
NM_005591.3         TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ------------------------------------AGTACTGCAGATGCACTTGATGAT
XM_005274008.1      AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005591.3         AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005590.3         ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
XM_005274007.1      ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
                                                        ** **:....:***.**: ***.*

HsCD00336657        GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
XM_005274008.1      TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005591.3         TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005590.3         GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
XM_005274007.1      GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
                     :*...:*.:**..*.:: :*.    .:.: .:**  :* * ..::::*:.*:.*.*.: 

HsCD00336657        GCAGTCAGAGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAA
XM_005274008.1      TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005591.3         TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005590.3         GCAGTCAGAGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAA
XM_005274007.1      GCAGTCAGAGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAA
                      .. .. *....*:***..*::   :: . * .*  :*:** *.* :*:* . .* ...

HsCD00336657        AATGAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGG
XM_005274008.1      AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005591.3         AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005590.3         AATGAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGG
XM_005274007.1      AATGAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGG
                    *.*.** : *.:: ** *:: **.. *  :**:*::*** : **:.* :: .   .:.  

HsCD00336657        AAAACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTC
XM_005274008.1      GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005591.3         GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005590.3         AAAACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTC
XM_005274007.1      AAAACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTC
                    .::* .* . . ..  ..*: **** :::** *..: .::  *:...***:*..*.  * 

HsCD00336657        CAGTTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTG
XM_005274008.1      TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005591.3         TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005590.3         CAGTTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTG
XM_005274007.1      CAGTTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTG
                     : *:*.:.: :*:.. **.:.. ***** .: : *  * **:  ...  : .*   **.

HsCD00336657        AACTATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCAT
XM_005274008.1      AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005591.3         AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005590.3         AACTATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCAT
XM_005274007.1      AACTATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCAT
                    ** :*:**:*:*** :: ** .. ***:.*.  . ..:*:* *.*** ***...*:**.*

HsCD00336657        GACGATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTGTGCTGGATTT
XM_005274008.1      CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005591.3         CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005590.3         GACGATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTGTGCTGGATTT
XM_005274007.1      GACGATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTGTGCTGGATTT
                     :  * .*.. . ** .. :*  ..*  . *. :* *: .*:  :*.* .* *:*..:**

HsCD00336657        GTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCCGGTTTTGCTT
XM_005274008.1      TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005591.3         TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005590.3         GTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCCGGTTTTGCTT
XM_005274007.1      GTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCCGGTTTTGCTT
                     *:** *.. :*..:* *:.*.*.:*  :.*. *:..:*..*:* :**  **: ::*.**

HsCD00336657        CAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAG-----------------------
XM_005274008.1      GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005591.3         GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005590.3         CAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAG-----------------------
XM_005274007.1      CAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAG-----------------------
                     **.**. ..  ..*** . **..* . *: ** *.*                       

HsCD00336657        --------------------GATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAA
XM_005274008.1      CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005591.3         CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005590.3         --------------------GATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAA
XM_005274007.1      --------------------GATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAA
                                        *.:* **:  .** *::: *.:* :*  *.****  **..

HsCD00336657        TAAAAAAGTAACAATGTTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGT
XM_005274008.1      TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005591.3         TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005590.3         TAAAAAAGTAACAATGTTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGT
XM_005274007.1      TAAAAAAGTAACAATGTTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGT
                    *::*.... **.::*** ** .  .:** :*.:  *.** :*:* .*  *: **:* :* 

HsCD00336657        GATTCATCAGAACAGGAGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGA
XM_005274008.1      CATAGAGAACAAAAGGAAAAAACAGG-AGAAGAGATCAACTTTGGGAAACTTATCACAAA
NM_005591.3         CATAGAGAACAAAAGGAAAAAACAGG-AGAAGAGATCAACTTTGGGAAACTTATCACAAA
NM_005590.3         GATTCATCAGAACAGGAGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGA
XM_005274007.1      GATTCATCAGAACAGGAGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGA
                     **: * .* **.****.:***** * *..:.. *:*::*:**  ..***:::* : ..*

HsCD00336657        TGACTTCATTGATCTTGTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAA
XM_005274008.1      GCCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGC
NM_005591.3         GCCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGC
NM_005590.3         TGACTTCATTGATCTTGTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAA
XM_005274007.1      TGACTTCATTGATCTTGTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAA
                      . * ..::*.:. :. *:*.:*** . *:**:*:**:.:.:.*.::.  **.****..

HsCD00336657        AAATGAACAACAGCTGTTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTC
XM_005274008.1      AGAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGA
NM_005591.3         AGAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGA
NM_005590.3         AAATGAACAACAGCTGTTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTC
XM_005274007.1      AAATGAACAACAGCTGTTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTC
                    *.* .*..*: :**:* * *.:.*   *..* .:.**.* : .*  *::.*:  :*:: .

HsCD00336657        CCCAGGAGAAGCTGTAAAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAA
XM_005274008.1      ATTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAA
NM_005591.3         ATTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAA
NM_005590.3         CCCAGGAGAAGCTGTAAAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAA
XM_005274007.1      CCCAGGAGAAGCTGTAAAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAA
                    .  :* .**... *:..***** ***  . * :* :.  :.* *** . ..*::*.:.**

HsCD00336657        TATGCATAAAATTCCTCTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGC
XM_005274008.1      AACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGA
NM_005591.3         AACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGA
NM_005590.3         TATGCATAAAATTCCTCTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGC
XM_005274007.1      TATGCATAAAATTCCTCTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGC
                    :* .** ..*:*** *.:: *.. : : .   *     **.:.** .*:** *:* :.*.

HsCD00336657        TAATCATCCAGACATTTTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTT
XM_005274008.1      GGTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCG
NM_005591.3         GGTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCG
NM_005590.3         TAATCATCCAGACATTTTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTT
XM_005274007.1      TAATCATCCAGACATTTTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTT
                     .::*.** : :** : ::*.*. * *:**:..**.:.::... ***. .:: **. *  

HsCD00336657        CTG---------------------------------------------------------
XM_005274008.1      TGAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTT
NM_005591.3         TGAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTT
NM_005590.3         CTG---------------------------------------------------------
XM_005274007.1      CTG---------------------------------------------------------
                      .                                                         

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      TAGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGA
NM_005591.3         TAGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00336657        ----------------------TTTGGAGAAGATTGAAGAAATGCTTGAAAATGCTGAAC
XM_005274008.1      TAGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAG
NM_005591.3         TAGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAG
NM_005590.3         ----------------------TTTGGAGAAGATTGAAGAAATGCTTGAAAATGCTGAAC
XM_005274007.1      ----------------------TTTGGAGAAGATTGAAGAAATGCTTGAAAATGCTGAAC
                                          :::***..**.  **.***.:* * ***.* *  *** 

HsCD00336657        GGGAAGGGCATCATCACCATCACCACTGA-------------------------------
XM_005274008.1      AGGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGA
NM_005591.3         AGGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGA
NM_005590.3         GGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAGCCTCTTGTACGACTGCGAGTGGACT
XM_005274007.1      GGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAGCCTCTTGTACGACTGCGAGTGGACT
                    .**.. * .:  . .*   : *  *   :                               

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      GACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTAT
NM_005591.3         GACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTAT
NM_005590.3         ATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGCTTTAGCCAGAAATTTGTGGATCGGG
XM_005274007.1      ATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGCTTTAGCCAGAAATTTGTGGATCGGG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      TATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTA
NM_005591.3         TATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTA
NM_005590.3         TAGCTAATCCAAAAGACATTATCCATTTTTTCAGGCATAGAGAACAAAAGGAAAAAACAG
XM_005274007.1      TAGCTAATCCAAAAGACATTATCCATTTTTTCAGGCATAGAGAACAAAAGGAAAAAACAG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      TTCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTC
NM_005591.3         TTCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTC
NM_005590.3         GAGAAGAGATCAACTTTGGGAAACTTATCACAAAGCCTTCAGAAGGAACAACTTTAAGGG
XM_005274007.1      GAGAAGAGATCAACTTTGGGAAACTTATCACAAAGCCTTCAGAAGGAACAACTTTAAGGG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      AAAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGT
NM_005591.3         AAAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGT
NM_005590.3         TAGAAGATCTTGTAAAACAGTACTTTCAAACCGCAGAGAAGAATGTGCAGCTCTCACTGC
XM_005274007.1      TAGAAGATCTTGTAAAACAGTACTTTCAAACCGCAGAGAAGAATGTGCAGCTCTCACTGC
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ATCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACAC
NM_005591.3         ATCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACAC
NM_005590.3         TAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAGGAGAAAGATG
XM_005274007.1      TAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAGGAGAAAGATG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      TAGTTCTTTAAGAAGAAATAGAAGATAA--------------------------------
NM_005591.3         TAGTTCTTTAAGAAGAAATAGAAGATAA--------------------------------
NM_005590.3         CCATTGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGCGATTTCTTAAAGAACGTC
XM_005274007.1      CCATTGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGCGATTTCTTAAAGAACGTC
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         ATATTGATGCCCTCGAAGACAAAATCGATGAGGAGGTACGTCGTTTCAGAGAAACCAGAC
XM_005274007.1      ATATTGATGCCCTCGAAGACAAAATCGATGAGGAGGTACGTCGTTTCAGAGAAACCAGAC
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AAAAAAATACTAATGAAGAAGATGATGAAGTCCGTGAGGCTATGACCAGGGCCAGAGCAC
XM_005274007.1      AAAAAAATACTAATGAAGAAGATGATGAAGTCCGTGAGGCTATGACCAGGGCCAGAGCAC
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTTAGTGCTGATGACCTTATGAGTATAG
XM_005274007.1      TCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTTAGTGCTGATGACCTTATGAGTATAG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         ATTTAGCAGAACAGATGGCTAATGACTCTGATGATAGCATCTCAGCAGCAACCAACAAAG
XM_005274007.1      ATTTAGCAGAACAGATGGCTAATGACTCTGATGATAGCATCTCAGCAGCAACCAACAAAG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGAGGGCAGAATTCAGCATCGAGAGGAG
XM_005274007.1      GAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGAGGGCAGAATTCAGCATCGAGAGGAG
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GGTCTCAAAGAGGAAGAGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTA
XM_005274007.1      GGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAGACTTCTACCCGTAGCAGGAACTCAA
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CTAAGAATTATTCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTC
XM_005274007.1      AGACTGCTGTGTCAGCATCTAGAAATATGTCTATTATAGATGCCTTTAAATCTACAAGAC
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CTACCACTTCAAAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCC
XM_005274007.1      AGCAGCCTTCCCGAAATGTCACTACTAAGAATTATTCAGAGGTGATTGAGGTAGATGAAT
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AGAGTCAAGTATCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTT
XM_005274007.1      CAGATGTGGAAGAAGACATTTTTCCTACCACTTCAAAGACAGATCAAAGGTGGTCCAGCA
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TTATGAACACTAGTTCTTTAAGAAGAAATAGAAGATAA----------------------
XM_005274007.1      CATCATCCAGCAAAATCATGTCCCAGAGTCAAGTATCGAAAGGGGTTGATTTTGAATCAA
                                                                                

HsCD00336657        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      GTGAGGATGATGATGATGATCCTTTTATGAACACTAGTTCTTTAAGAAGAAATAGAAGAT
                                                                                

HsCD00336657        --
XM_005274008.1      --
NM_005591.3         --
NM_005590.3         --
XM_005274007.1      AA
                      

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : STING mediated induction of host immune responses
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Non-homologous end joining
WikiPathway : miRNA regulation of DNA Damage Response

Protein

Structural Annotation Wiki : TOPSAN
UniProt : P49959
UniProt : Q05D78
HPRD : 02889

Clone

Cloning Information : 495274
HIP Master Clone ID : 408954
Original Clone ID : 8658a8BCt5p1

Experimental

TargetTrack - Experimental data : NYSGXRC-8658a

Organism


TAX_ID : 9606
Species Specific ID: 4361

Genome

Chromosome : 11
Map Location : 11q21
Ensembl : ENSG00000020922

Reagents

Labome : Mre11-antibody