DNASU Plasmid Repository • 480.965.5697 | Email

MLP28 (A. thaliana Columbia ) in pVP13 (S, MBP and His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MLP28
Gene Name:  MLP-like protein 28
Sequence             
Original Clone ID: 5468.1.14_GO.6759
Keyword: full-length cds
Species: Arabidopsis thaliana Columbia
Type: cDNA
Vector Name: pVP13               Format:  FUSION
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: His8-MBP fusion protein with TEV protease cleavage site is produced; after cleavage the protein obtained will be the translated CDS with the addition of SER at the N-term
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
Center for Eukaryotic Structural Genomics
AtCD00336806

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1026nts         Open reading frame : 1 to 1026

GAAAACCTGTACTTCCAGTCCGCCGACGTAGCAACAAAGCACCCCATGGAAGATGAGGTG
AAGAAGACGGAGGCGTCTAGTTTGGTGGGGAAGCTAGAGACAGACGTGGAGATCAAGGCT
TCGGCTGATAAGTTTCACCACATGTTCGCTGGGAAACCACACCATGTCTCCAAAGCAAGT
CCAGGCAACATTCAGGGATGTGATCTGCACGAAGGCGACTGGGGCACAGTCGGCTCTATC
GTCTTCTGGAATTACGTACATGATGGGGAGGCAAAGGTGGCGAAGGAGAGGATCGAGGCG
GTGGAGCCAGATAAGAACTTGATCACGTTTAGGGTTATAGAAGGTGATCTGATGAAAGAG
TACAAGAGCTTCTTGCTCACCATCCAGGTGACCCCTAAGCCTGGAGGCCCTGGAAGTATT
GTGCACTGGCACCTTGAGTATGAGAAAATTAGCGAGGAGGTAGCTCACCCGGAAACTCTC
CTCCAGTTCTGTGTCGAGGTCTCCAAAGAGATCGACGAACATCTCTTGGCCGAGGAAGAG
GAGGTGAAGACACCAGAGACGCCTAGTTTGGTGGGAAAGCTAGAGACAGACGTGGAGATC
AAAGCTTCCGCTGAGAAGTTCCATCACATGTTCGCCGGGAAACCACACCATGTCTCTAAA
GCATCTCCAGGAAACATTCAAGGTTGTGATCTTCACGAAGGCGACTGGGGTCAAGTCGGC
TCTATCGTCTTCTGGAACTACGTTCATGATAGAGAGGCAAAGGTGGCTAAGGAGAGGATT
GAGGCAGTGGAGCCGAATAAGAACTTGATCACGTTTAGGGTTATCGACGGTGATCTGATG
AAAGAGTACAAGAGCTTCTTGCTCACGATCCAGGTGACCCCGAAGCTTGGAGGCCCTGGA
AGTATTGTGCACTGGCACCTTGAGTATGAGAAAATAAGCGAGGAGGTAGCTCATCCGGAA
ACTCTCCTCCAATTCTGTGTCGAGGTCTCGAAAGAGATCGACGAACATCTTTTGGCCGAG
GAATAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
ins@1023,3
                                

5' Linker Sequence:
ACAAGTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
GACCCAGCTTTCTTGTACAAAGTGGT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in GO.6759
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP13

pVP13 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  pQE Reverse
Description: Bacterial (E. coli) expression, adds N-terminal S-tag, 6xHis and MBP, adds TEV site on 5p end of insert; ampicillin resistance in bacteria; recombinational cloning; Gateway cloning into this vector will remove the Gateway ccdB death casette.
Comments: TEV protease cleavage site is "partial" and not functional. The TEV cleavage site must be added to the insert by PCR, which allows amino acids encoded by the attB1 site to be cut off after protein expression. Gateway cloning into this vector will remove the Gateway cassette
Size (bp): 7675
Parent Vector: None
Empty Vector: EvNO00084278
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15750721
Title: Results from high-throughput DNA cloning of Arabidopsis thaliana target genes using site-specific recombination

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 6516 5834
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 2688 2897
promoter T5 T5 promoter 7 87
recombination site AttR1 AttR1 recombination site 1361 1485
recombination site AttR2 AttR2 recombination site 3065 2941
repressor binding site LacI LacI coding sequence 4177 5256
selectable marker CmR chloramphenicol resistance gene (CmR) (lost in with-insert form) 1594 2250
selectable marker AmpR ampicillin resistance gene 7273 6614
tag His N-terminal 6xHis tag 173 190
tag S-tag N-terminal S-tag 116 152
tag MBP N-terminal MBP tag 193 1291

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MLP28
SYNONYM : F15H11.8; F15H11_8; MLP-like protein 28
GENEID : 843420
Locus Tag : AT1G70830
GI : 30698751
GenBank Accession : NM_179544
TAIR : AT1G70830
Target GenBank: NM_179544

 

Protein

SMART domain : Bet_v_1 : Pathogenesis-related protein Bet v I family
Structural Annotation Wiki : TOPSAN
UniProt : Q9SSK9
UniProt : A8MR61
UniProt : B3H4F3
UniProt : A8MRH3

Clone

Cloning Information : 510127
HIP Master Clone ID : 421294
Original Clone ID : 5468.1.14_GO.6759

Experimental

TargetTrack - Experimental data : GO.6759

Organism


TAX_ID : 3702
Species Specific ID: 843420

Genome

Chromosome : 1

Reagents

Labome : MLP28-cDNA