DNASU Plasmid Repository • 480.965.5697 | Email

sdpB (B. subtilis subsp. subtilis str. 168 ) in pNYCOMPS-LIC-FH10T+ (N term)

TOP

Explanation of Terms


Gene: Gene Symbol:  sdpB
Gene Name:  sporulation-delaying protein SdpB
Sequence             
Original Clone ID: GE.393.1.63_GO.10304
Keyword: None
Species: Bacillus subtilis subsp. subtilis str. 168
Type: cDNA
Vector Name: pNYCOMPS-LIC-FH10T+ (N term)               Format:  CLOSED
Source: New York Consortium on Membrane Protein Structure
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
New York Consortium on Membrane Protein Structure
BsCD00337268

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 972nts        
Open reading frame : 1 to 972

ATGAAGATATTAAATAGTTTAGAAGGTTATATTGACACCTATAATCCATGGAAAAATACA
TATGCACTTTTTAGAAGTTTACTTGGTTTCTCAACATTACTAGTACTATTATTCAATAGT
ACTGATATTTTATTTAGTTATAGTGCAAATAATGTCACATGTGAAAATGTCTATATCCCT
ACCGCTTTTTGTTTTGCTAAAGAATATAGTATCAATTTTGAGATTATAAGATACTTAATG
ATTTTTATATTAACCTTAGTGGTTATAGGGTGGAGACCTAGATTTACCGGTTTATTTCAC
TGGTATATTTGCTATAGTATTCAAACTTCAGCTTTAACTATCGATGGTGGAGAGCAAATT
GCAACTGTTCTTTCTTTTCTTATATTACCTGTTACATTATTAGATTCAAGGCGAAATCAT
TGGAATATAAAGAAAAACAATAATGAATCTTTCACAAAGAAGACAGTATTGTTTTATATA
ATGACAATAATTAAAATTCAAGTTTTTATCATTTATTTAAACGCAGCTTTAGAGCGATTG
AAAAATAAAGAGTGGGCAGAAGGAACAGCAATTTACTATTTCTTTTCTGATCCGGTGTTT
GGATTACCTGAATATCAACTTAACTTAATGAATCCACTACTTGAAAGCAATTTTATTGTT
GTCATCACTTGGTTAGTAACTATTTTTGAGTTGTTCTTAGCAGCAAGCATAATTTCAAAT
ATCAGAATAAAGAGAATTGCCCTTGTTTTGGGAATATTATTTCATATTGGGATAATATTC
AGCATTGGTATTGTAAGTTTTGGCTTGATCATGATATCAGCATTAATTATATATCTGCAT
CCTGTACAACAAAATATCACTATGAATTGGTGTTCTCCTTTATTTAAATATATATATGTA
AAAGGAAAGAGAAATTTCAAAAGAATAGGAGGTGAATCAGTCAAGTTTCTTACAAAATTG
TTTCATAGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a972g,*324*
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: SolubleProtein: Not_Applicable
ProteinExpressed: Tested_Not_Found
ProteinPurified: Tested_Not_Purified
Find experimental protocols in GO.10304
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pNYCOMPS-LIC-FH10T+ (N term)

pNYCOMPS-LIC-FH10TNterm in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector; T7 promoter; N terminal Flag epitope and 10X His tags; tags can be removed by TEV protease; kanamycin resistance; ligation independent cloning.
Comments: None
Size (bp): 6984
Parent Vector: None
Empty Vector: EvNO00091443
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: New York Consortium on Membrane Protein Structure
New York Structural Biology Center
Publications: PMID: 20394823
Title: High-throughput expression and purification of membrane proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 1583 2265
death cassette ccdB ccdB death cassette (removed in plasmids containing an insert) 5393 5602
promoter T7 T7 promoter 5146 5165
protease cleavage site TEV TEV protease cleavage site 5290 5310
repressor protein gene LacI Lac inhibitor 3677 4693
ribosome binding site RBS Ribosome Binding Site 5225 5230
selectable marker KanR kanamycin resistance 725 1537
selectable marker CmR Chloramphenicol resistance gene 6040 6696
tag Flag Flag epitope tag; N terminal 5236 5259
tag His 10xHis tag; N terminal 5260 5289
trxn regulatory element lac operator lac operator 5165 5187
trxn termination sequence T7 term T7 terminator 91 137

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : sdpB
GENEID : 936240
Locus Tag : BSU33760
GI : 16080429
Target GenBank: None

 

Protein

SMART domain : HTTM : Horizontally Transferred TransMembrane Domain
Structural Annotation Wiki : TOPSAN
UniProt : O34616

Clone

Cloning Information : 550456
HIP Master Clone ID : 460776
Original Clone ID : GE.393.1.63_GO.10304

Experimental

TargetTrack - Experimental data : GO.10304

Organism


TAX_ID : 224308
Species Specific ID: 936240

Reagents

Labome : sdpB-cDNA