DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  STAT3
Gene Name:  signal transducer and activator of transcription 3 (acute-phase response factor)
Sequence             
Original Clone ID: HR5535B-1-116-14.3
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Northeast Structural Genomics Consortium
HsCD00338451

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 351nts         Open reading frame : 1 to 351
Reference Sequence Alignment

ATGGCCCAATGGAATCAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAG
CTCTACAGTGACAGCTTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGT
CAAGATTGGGCATATGCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTC
CTGGGAGAGATTGACCCGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAG
CACAATCTACGAAGAATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAG
ATTGCCCGGATTGTGGCCCGGTGCCTGTGGGACGAATCACGCCTTCTATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a197c,Q66P;a333c,E111D
                                

5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
Find experimental protocols in HR5535B
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : STAT3
Symbol Nomenclature : STAT3
SYNONYM : APRF; HIES
Designation : DNA-binding protein APRF|acute-phase response factor|signal transducer and activator of transcription 3
Full Nomenclature : signal transducer and activator of transcription 3 (acute-phase response factor)
GENEID : 6774
HGNC : 11364
MIM : 102582
Vega : OTTHUMG00000150645
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ------------------------------------------------------------
XM_005257616.1      ATGACGGCGTGCCTCGGCCAGGCTGGGGCTGGGCGAGGATTGGCTGAAGGGGCTGTAATT
NM_139276.2         ------------------------------------------------------------
XM_005257618.1      ATGACGGCGTGCCTCGGCCAGGCTGGGGCTGGGCGAGGATTGGCTGAAGGGGCTGTAATT
NM_003150.3         ------------------------------------------------------------
XM_005257617.1      ATGACGGCGTGCCTCGGCCAGGCTGGGGCTGGGCGAGGATTGGCTGAAGGGGCTGTAATT
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ------------------------------------------------------------
XM_005257616.1      CAGCGGTTTCCGGAGCTGCGGCGGCGCAGACTGGGAGGGGGAGCCGGGGGTTCCGACGTC
NM_139276.2         ------------------------------------------------------------
XM_005257618.1      CAGCGGTTTCCGGAGCTGCGGCGGCGCAGACTGGGAGGGGGAGCCGGGGGTTCCGACGTC
NM_003150.3         ------------------------------------------------------------
XM_005257617.1      CAGCGGTTTCCGGAGCTGCGGCGGCGCAGACTGGGAGGGGGAGCCGGGGGTTCCGACGTC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ------------------------------------------------------------
XM_005257616.1      GCAGCCGAGGGAACAAGCCCCAACCGGATCCTGGACAGGCACCCCGGCTTGGCGCTGTCT
NM_139276.2         ------------------------------------------------------------
XM_005257618.1      GCAGCCGAGGGAACAAGCCCCAACCGGATCCTGGACAGGCACCCCGGCTTGGCGCTGTCT
NM_003150.3         ------------------------------------------------------------
XM_005257617.1      GCAGCCGAGGGAACAAGCCCCAACCGGATCCTGGACAGGCACCCCGGCTTGGCGCTGTCT
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ------------------------------------------------------------
XM_005257616.1      CTCCCCCTCGGCTCGGAGAGGCCCTTCGGCCTGAGGGAGCCTCGCCGCCCGTCCCCGGCA
NM_139276.2         ------------------------------------------------------------
XM_005257618.1      CTCCCCCTCGGCTCGGAGAGGCCCTTCGGCCTGAGGGAGCCTCGCCGCCCGTCCCCGGCA
NM_003150.3         ------------------------------------------------------------
XM_005257617.1      CTCCCCCTCGGCTCGGAGAGGCCCTTCGGCCTGAGGGAGCCTCGCCGCCCGTCCCCGGCA
                                                                                

HsCD00338451        ---------------------------------------------ATGGCCCAATGGAAT
NM_213662.1         ---------------------------------------------ATGGCCCAATGGAAT
XM_005257616.1      CACGCGCAGCCCCGGCCTCTCGGCCTCTGCCGGAGAAACAGCAGGATGGCCCAATGGAAT
NM_139276.2         ---------------------------------------------ATGGCCCAATGGAAT
XM_005257618.1      CACGCGCAGCCCCGGCCTCTCGGCCTCTGCCG---GAGAAACAGGATGGCCCAATGGAAT
NM_003150.3         ---------------------------------------------ATGGCCCAATGGAAT
XM_005257617.1      CACGCGCAGCCCCGGCCTCTCG---GCCTCTGCCGGAGAAACAGGATGGCCCAATGGAAT
                                                                 ***************

HsCD00338451        CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
NM_213662.1         CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
XM_005257616.1      CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
NM_139276.2         CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
XM_005257618.1      CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
NM_003150.3         CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
XM_005257617.1      CAGCTACAGCAGCTTGACACACGGTACCTGGAGCAGCTCCATCAGCTCTACAGTGACAGC
                    ************************************************************

HsCD00338451        TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
NM_213662.1         TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
XM_005257616.1      TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
NM_139276.2         TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
XM_005257618.1      TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
NM_003150.3         TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
XM_005257617.1      TTCCCAATGGAGCTGCGGCAGTTTCTGGCCCCTTGGATTGAGAGTCAAGATTGGGCATAT
                    ************************************************************

HsCD00338451        GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
NM_213662.1         GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
XM_005257616.1      GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
NM_139276.2         GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
XM_005257618.1      GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
NM_003150.3         GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
XM_005257617.1      GCGGCCAGCAAAGAATCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGAC
                    ************************************************************

HsCD00338451        CCGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
NM_213662.1         CAGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
XM_005257616.1      CAGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
NM_139276.2         CAGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
XM_005257618.1      CAGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
NM_003150.3         CAGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
XM_005257617.1      CAGCAGTATAGCCGCTTCCTGCAAGAGTCGAATGTTCTCTATCAGCACAATCTACGAAGA
                    *.**********************************************************

HsCD00338451        ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
NM_213662.1         ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
XM_005257616.1      ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
NM_139276.2         ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
XM_005257618.1      ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
NM_003150.3         ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
XM_005257617.1      ATCAAGCAGTTTCTTCAGAGCAGGTATCTTGAGAAGCCAATGGAGATTGCCCGGATTGTG
                    ************************************************************

HsCD00338451        GCCCGGTGCCTGTGGGACGAATCACGCCTTCTATAG------------------------
NM_213662.1         GCCCGGTGCCTGTGGGAAGAATCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGCAA
XM_005257616.1      GCCCGGTGCCTGTGGGAAGAATCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGCAA
NM_139276.2         GCCCGGTGCCTGTGGGAAGAATCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGCAA
XM_005257618.1      GCCCGGTGCCTGTGGGAAGAATCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGCAA
NM_003150.3         GCCCGGTGCCTGTGGGAAGAATCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGCAA
XM_005257617.1      GCCCGGTGCCTGTGGGAAGAATCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGCAA
                    *****************.*************** **                        

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GGGGGCCAGGCCAACCACCCCACAGCAGCCGTGGTGACGGAGAAGCAGCAGATGCTGGAG
XM_005257616.1      GGGGGCCAGGCCAACCACCCCACAGCAGCCGTGGTGACGGAGAAGCAGCAGATGCTGGAG
NM_139276.2         GGGGGCCAGGCCAACCACCCCACAGCAGCCGTGGTGACGGAGAAGCAGCAGATGCTGGAG
XM_005257618.1      GGGGGCCAGGCCAACCACCCCACAGCAGCCGTGGTGACGGAGAAGCAGCAGATGCTGGAG
NM_003150.3         GGGGGCCAGGCCAACCACCCCACAGCAGCCGTGGTGACGGAGAAGCAGCAGATGCTGGAG
XM_005257617.1      GGGGGCCAGGCCAACCACCCCACAGCAGCCGTGGTGACGGAGAAGCAGCAGATGCTGGAG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         CAGCACCTTCAGGATGTCCGGAAGAGAGTGCAGGATCTAGAACAGAAAATGAAAGTGGTA
XM_005257616.1      CAGCACCTTCAGGATGTCCGGAAGAGAGTGCAGGATCTAGAACAGAAAATGAAAGTGGTA
NM_139276.2         CAGCACCTTCAGGATGTCCGGAAGAGAGTGCAGGATCTAGAACAGAAAATGAAAGTGGTA
XM_005257618.1      CAGCACCTTCAGGATGTCCGGAAGAGAGTGCAGGATCTAGAACAGAAAATGAAAGTGGTA
NM_003150.3         CAGCACCTTCAGGATGTCCGGAAGAGAGTGCAGGATCTAGAACAGAAAATGAAAGTGGTA
XM_005257617.1      CAGCACCTTCAGGATGTCCGGAAGAGAGTGCAGGATCTAGAACAGAAAATGAAAGTGGTA
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GAGAATCTCCAGGATGACTTTGATTTCAACTATAAAACCCTCAAGAGTCAAGGAGACATG
XM_005257616.1      GAGAATCTCCAGGATGACTTTGATTTCAACTATAAAACCCTCAAGAGTCAAGGAGACATG
NM_139276.2         GAGAATCTCCAGGATGACTTTGATTTCAACTATAAAACCCTCAAGAGTCAAGGAGACATG
XM_005257618.1      GAGAATCTCCAGGATGACTTTGATTTCAACTATAAAACCCTCAAGAGTCAAGGAGACATG
NM_003150.3         GAGAATCTCCAGGATGACTTTGATTTCAACTATAAAACCCTCAAGAGTCAAGGAGACATG
XM_005257617.1      GAGAATCTCCAGGATGACTTTGATTTCAACTATAAAACCCTCAAGAGTCAAGGAGACATG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         CAAGATCTGAATGGAAACAACCAGTCAGTGACCAGGCAGAAGATGCAGCAGCTGGAACAG
XM_005257616.1      CAAGATCTGAATGGAAACAACCAGTCAGTGACCAGGCAGAAGATGCAGCAGCTGGAACAG
NM_139276.2         CAAGATCTGAATGGAAACAACCAGTCAGTGACCAGGCAGAAGATGCAGCAGCTGGAACAG
XM_005257618.1      CAAGATCTGAATGGAAACAACCAGTCAGTGACCAGGCAGAAGATGCAGCAGCTGGAACAG
NM_003150.3         CAAGATCTGAATGGAAACAACCAGTCAGTGACCAGGCAGAAGATGCAGCAGCTGGAACAG
XM_005257617.1      CAAGATCTGAATGGAAACAACCAGTCAGTGACCAGGCAGAAGATGCAGCAGCTGGAACAG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ATGCTCACTGCGCTGGACCAGATGCGGAGAAGCATCGTGAGTGAGCTGGCGGGGCTTTTG
XM_005257616.1      ATGCTCACTGCGCTGGACCAGATGCGGAGAAGCATCGTGAGTGAGCTGGCGGGGCTTTTG
NM_139276.2         ATGCTCACTGCGCTGGACCAGATGCGGAGAAGCATCGTGAGTGAGCTGGCGGGGCTTTTG
XM_005257618.1      ATGCTCACTGCGCTGGACCAGATGCGGAGAAGCATCGTGAGTGAGCTGGCGGGGCTTTTG
NM_003150.3         ATGCTCACTGCGCTGGACCAGATGCGGAGAAGCATCGTGAGTGAGCTGGCGGGGCTTTTG
XM_005257617.1      ATGCTCACTGCGCTGGACCAGATGCGGAGAAGCATCGTGAGTGAGCTGGCGGGGCTTTTG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TCAGCGATGGAGTACGTGCAGAAAACTCTCACGGACGAGGAGCTGGCTGACTGGAAGAGG
XM_005257616.1      TCAGCGATGGAGTACGTGCAGAAAACTCTCACGGACGAGGAGCTGGCTGACTGGAAGAGG
NM_139276.2         TCAGCGATGGAGTACGTGCAGAAAACTCTCACGGACGAGGAGCTGGCTGACTGGAAGAGG
XM_005257618.1      TCAGCGATGGAGTACGTGCAGAAAACTCTCACGGACGAGGAGCTGGCTGACTGGAAGAGG
NM_003150.3         TCAGCGATGGAGTACGTGCAGAAAACTCTCACGGACGAGGAGCTGGCTGACTGGAAGAGG
XM_005257617.1      TCAGCGATGGAGTACGTGCAGAAAACTCTCACGGACGAGGAGCTGGCTGACTGGAAGAGG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         CGGCAACAGATTGCCTGCATTGGAGGCCCGCCCAACATCTGCCTAGATCGGCTAGAAAAC
XM_005257616.1      CGGCAACAGATTGCCTGCATTGGAGGCCCGCCCAACATCTGCCTAGATCGGCTAGAAAAC
NM_139276.2         CGGCAACAGATTGCCTGCATTGGAGGCCCGCCCAACATCTGCCTAGATCGGCTAGAAAAC
XM_005257618.1      CGGCAACAGATTGCCTGCATTGGAGGCCCGCCCAACATCTGCCTAGATCGGCTAGAAAAC
NM_003150.3         CGGCAACAGATTGCCTGCATTGGAGGCCCGCCCAACATCTGCCTAGATCGGCTAGAAAAC
XM_005257617.1      CGGCAACAGATTGCCTGCATTGGAGGCCCGCCCAACATCTGCCTAGATCGGCTAGAAAAC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TGGATAACGTCATTAGCAGAATCTCAACTTCAGACCCGTCAACAAATTAAGAAACTGGAG
XM_005257616.1      TGGATAACGTCATTAGCAGAATCTCAACTTCAGACCCGTCAACAAATTAAGAAACTGGAG
NM_139276.2         TGGATAACGTCATTAGCAGAATCTCAACTTCAGACCCGTCAACAAATTAAGAAACTGGAG
XM_005257618.1      TGGATAACGTCATTAGCAGAATCTCAACTTCAGACCCGTCAACAAATTAAGAAACTGGAG
NM_003150.3         TGGATAACGTCATTAGCAGAATCTCAACTTCAGACCCGTCAACAAATTAAGAAACTGGAG
XM_005257617.1      TGGATAACGTCATTAGCAGAATCTCAACTTCAGACCCGTCAACAAATTAAGAAACTGGAG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GAGTTGCAGCAAAAAGTTTCCTACAAAGGGGACCCCATTGTACAGCACCGGCCGATGCTG
XM_005257616.1      GAGTTGCAGCAAAAAGTTTCCTACAAAGGGGACCCCATTGTACAGCACCGGCCGATGCTG
NM_139276.2         GAGTTGCAGCAAAAAGTTTCCTACAAAGGGGACCCCATTGTACAGCACCGGCCGATGCTG
XM_005257618.1      GAGTTGCAGCAAAAAGTTTCCTACAAAGGGGACCCCATTGTACAGCACCGGCCGATGCTG
NM_003150.3         GAGTTGCAGCAAAAAGTTTCCTACAAAGGGGACCCCATTGTACAGCACCGGCCGATGCTG
XM_005257617.1      GAGTTGCAGCAAAAAGTTTCCTACAAAGGGGACCCCATTGTACAGCACCGGCCGATGCTG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GAGGAGAGAATCGTGGAGCTGTTTAGAAACTTAATGAAAAGTGCCTTTGTGGTGGAGCGG
XM_005257616.1      GAGGAGAGAATCGTGGAGCTGTTTAGAAACTTAATGAAAAGTGCCTTTGTGGTGGAGCGG
NM_139276.2         GAGGAGAGAATCGTGGAGCTGTTTAGAAACTTAATGAAAAGTGCCTTTGTGGTGGAGCGG
XM_005257618.1      GAGGAGAGAATCGTGGAGCTGTTTAGAAACTTAATGAAAAGTGCCTTTGTGGTGGAGCGG
NM_003150.3         GAGGAGAGAATCGTGGAGCTGTTTAGAAACTTAATGAAAAGTGCCTTTGTGGTGGAGCGG
XM_005257617.1      GAGGAGAGAATCGTGGAGCTGTTTAGAAACTTAATGAAAAGTGCCTTTGTGGTGGAGCGG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         CAGCCCTGCATGCCCATGCATCCTGACCGGCCCCTCGTCATCAAGACCGGCGTCCAGTTC
XM_005257616.1      CAGCCCTGCATGCCCATGCATCCTGACCGGCCCCTCGTCATCAAGACCGGCGTCCAGTTC
NM_139276.2         CAGCCCTGCATGCCCATGCATCCTGACCGGCCCCTCGTCATCAAGACCGGCGTCCAGTTC
XM_005257618.1      CAGCCCTGCATGCCCATGCATCCTGACCGGCCCCTCGTCATCAAGACCGGCGTCCAGTTC
NM_003150.3         CAGCCCTGCATGCCCATGCATCCTGACCGGCCCCTCGTCATCAAGACCGGCGTCCAGTTC
XM_005257617.1      CAGCCCTGCATGCCCATGCATCCTGACCGGCCCCTCGTCATCAAGACCGGCGTCCAGTTC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ACTACTAAAGTCAGGTTGCTGGTCAAATTCCCTGAGTTGAATTATCAGCTTAAAATTAAA
XM_005257616.1      ACTACTAAAGTCAGGTTGCTGGTCAAATTCCCTGAGTTGAATTATCAGCTTAAAATTAAA
NM_139276.2         ACTACTAAAGTCAGGTTGCTGGTCAAATTCCCTGAGTTGAATTATCAGCTTAAAATTAAA
XM_005257618.1      ACTACTAAAGTCAGGTTGCTGGTCAAATTCCCTGAGTTGAATTATCAGCTTAAAATTAAA
NM_003150.3         ACTACTAAAGTCAGGTTGCTGGTCAAATTCCCTGAGTTGAATTATCAGCTTAAAATTAAA
XM_005257617.1      ACTACTAAAGTCAGGTTGCTGGTCAAATTCCCTGAGTTGAATTATCAGCTTAAAATTAAA
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GTGTGCATTGACAAAGACTCTGGGGACGTTGCAGCTCTCAGAGGATCCCGGAAATTTAAC
XM_005257616.1      GTGTGCATTGACAAAGACTCTGGGGACGTTGCAGCTCTCAGAGGATCCCGGAAATTTAAC
NM_139276.2         GTGTGCATTGACAAAGACTCTGGGGACGTTGCAGCTCTCAGAGGATCCCGGAAATTTAAC
XM_005257618.1      GTGTGCATTGACAAAGACTCTGGGGACGTTGCAGCTCTCAGAGGATCCCGGAAATTTAAC
NM_003150.3         GTGTGCATTGACAAAGACTCTGGGGACGTTGCAGCTCTCAGAGGATCCCGGAAATTTAAC
XM_005257617.1      GTGTGCATTGACAAAGACTCTGGGGACGTTGCAGCTCTCAGAGGATCCCGGAAATTTAAC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ATTCTGGGCACAAACACAAAAGTGATGAACATGGAAGAATCCAACAACGGCAGCCTCTCT
XM_005257616.1      ATTCTGGGCACAAACACAAAAGTGATGAACATGGAAGAATCCAACAACGGCAGCCTCTCT
NM_139276.2         ATTCTGGGCACAAACACAAAAGTGATGAACATGGAAGAATCCAACAACGGCAGCCTCTCT
XM_005257618.1      ATTCTGGGCACAAACACAAAAGTGATGAACATGGAAGAATCCAACAACGGCAGCCTCTCT
NM_003150.3         ATTCTGGGCACAAACACAAAAGTGATGAACATGGAAGAATCCAACAACGGCAGCCTCTCT
XM_005257617.1      ATTCTGGGCACAAACACAAAAGTGATGAACATGGAAGAATCCAACAACGGCAGCCTCTCT
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GCAGAATTCAAACACTTGACCCTGAGGGAGCAGAGATGTGGGAATGGGGGCCGAGCCAAT
XM_005257616.1      GCAGAATTCAAACACTTGACCCTGAGGGAGCAGAGATGTGGGAATGGGGGCCGAGCCAAT
NM_139276.2         GCAGAATTCAAACACTTGACCCTGAGGGAGCAGAGATGTGGGAATGGGGGCCGAGCCAAT
XM_005257618.1      GCAGAATTCAAACACTTGACCCTGAGGGAGCAGAGATGTGGGAATGGGGGCCGAGCCAAT
NM_003150.3         GCAGAATTCAAACACTTGACCCTGAGGGAGCAGAGATGTGGGAATGGGGGCCGAGCCAAT
XM_005257617.1      GCAGAATTCAAACACTTGACCCTGAGGGAGCAGAGATGTGGGAATGGGGGCCGAGCCAAT
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TGTGATGCTTCCCTGATTGTGACTGAGGAGCTGCACCTGATCACCTTTGAGACCGAGGTG
XM_005257616.1      TGTGATGCTTCCCTGATTGTGACTGAGGAGCTGCACCTGATCACCTTTGAGACCGAGGTG
NM_139276.2         TGTGATGCTTCCCTGATTGTGACTGAGGAGCTGCACCTGATCACCTTTGAGACCGAGGTG
XM_005257618.1      TGTGATGCTTCCCTGATTGTGACTGAGGAGCTGCACCTGATCACCTTTGAGACCGAGGTG
NM_003150.3         TGTGATGCTTCCCTGATTGTGACTGAGGAGCTGCACCTGATCACCTTTGAGACCGAGGTG
XM_005257617.1      TGTGATGCTTCCCTGATTGTGACTGAGGAGCTGCACCTGATCACCTTTGAGACCGAGGTG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TATCACCAAGGCCTCAAGATTGACCTAGAGACCCACTCCTTGCCAGTTGTGGTGATCTCC
XM_005257616.1      TATCACCAAGGCCTCAAGATTGACCTAGAGACCCACTCCTTGCCAGTTGTGGTGATCTCC
NM_139276.2         TATCACCAAGGCCTCAAGATTGACCTAGAGACCCACTCCTTGCCAGTTGTGGTGATCTCC
XM_005257618.1      TATCACCAAGGCCTCAAGATTGACCTAGAGACCCACTCCTTGCCAGTTGTGGTGATCTCC
NM_003150.3         TATCACCAAGGCCTCAAGATTGACCTAGAGACCCACTCCTTGCCAGTTGTGGTGATCTCC
XM_005257617.1      TATCACCAAGGCCTCAAGATTGACCTAGAGACCCACTCCTTGCCAGTTGTGGTGATCTCC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         AACATCTGTCAGATGCCAAATGCCTGGGCGTCCATCCTGTGGTACAACATGCTGACCAAC
XM_005257616.1      AACATCTGTCAGATGCCAAATGCCTGGGCGTCCATCCTGTGGTACAACATGCTGACCAAC
NM_139276.2         AACATCTGTCAGATGCCAAATGCCTGGGCGTCCATCCTGTGGTACAACATGCTGACCAAC
XM_005257618.1      AACATCTGTCAGATGCCAAATGCCTGGGCGTCCATCCTGTGGTACAACATGCTGACCAAC
NM_003150.3         AACATCTGTCAGATGCCAAATGCCTGGGCGTCCATCCTGTGGTACAACATGCTGACCAAC
XM_005257617.1      AACATCTGTCAGATGCCAAATGCCTGGGCGTCCATCCTGTGGTACAACATGCTGACCAAC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         AATCCCAAGAATGTAAACTTTTTTACCAAGCCCCCAATTGGAACCTGGGATCAAGTGGCC
XM_005257616.1      AATCCCAAGAATGTAAACTTTTTTACCAAGCCCCCAATTGGAACCTGGGATCAAGTGGCC
NM_139276.2         AATCCCAAGAATGTAAACTTTTTTACCAAGCCCCCAATTGGAACCTGGGATCAAGTGGCC
XM_005257618.1      AATCCCAAGAATGTAAACTTTTTTACCAAGCCCCCAATTGGAACCTGGGATCAAGTGGCC
NM_003150.3         AATCCCAAGAATGTAAACTTTTTTACCAAGCCCCCAATTGGAACCTGGGATCAAGTGGCC
XM_005257617.1      AATCCCAAGAATGTAAACTTTTTTACCAAGCCCCCAATTGGAACCTGGGATCAAGTGGCC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GAGGTCCTGAGCTGGCAGTTCTCCTCCACCACCAAGCGAGGACTGAGCATCGAGCAGCTG
XM_005257616.1      GAGGTCCTGAGCTGGCAGTTCTCCTCCACCACCAAGCGAGGACTGAGCATCGAGCAGCTG
NM_139276.2         GAGGTCCTGAGCTGGCAGTTCTCCTCCACCACCAAGCGAGGACTGAGCATCGAGCAGCTG
XM_005257618.1      GAGGTCCTGAGCTGGCAGTTCTCCTCCACCACCAAGCGAGGACTGAGCATCGAGCAGCTG
NM_003150.3         GAGGTCCTGAGCTGGCAGTTCTCCTCCACCACCAAGCGAGGACTGAGCATCGAGCAGCTG
XM_005257617.1      GAGGTCCTGAGCTGGCAGTTCTCCTCCACCACCAAGCGAGGACTGAGCATCGAGCAGCTG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ACTACACTGGCAGAGAAACTCTTGGGACCTGGTGTGAATTATTCAGGGTGTCAGATCACA
XM_005257616.1      ACTACACTGGCAGAGAAACTCTTGGGACCTGGTGTGAATTATTCAGGGTGTCAGATCACA
NM_139276.2         ACTACACTGGCAGAGAAACTCTTGGGACCTGGTGTGAATTATTCAGGGTGTCAGATCACA
XM_005257618.1      ACTACACTGGCAGAGAAACTCTTGGGACCTGGTGTGAATTATTCAGGGTGTCAGATCACA
NM_003150.3         ACTACACTGGCAGAGAAACTCTTGGGACCTGGTGTGAATTATTCAGGGTGTCAGATCACA
XM_005257617.1      ACTACACTGGCAGAGAAACTCTTGGGACCTGGTGTGAATTATTCAGGGTGTCAGATCACA
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTG
XM_005257616.1      TGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTG
NM_139276.2         TGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTG
XM_005257618.1      TGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTG
NM_003150.3         TGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTG
XM_005257617.1      TGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         GACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATC
XM_005257616.1      GACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATC
NM_139276.2         GACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATC
XM_005257618.1      GACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATC
NM_003150.3         GACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATC
XM_005257617.1      GACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACC
XM_005257616.1      ATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACC
NM_139276.2         ATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACC
XM_005257618.1      ATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACC
NM_003150.3         ATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACC
XM_005257617.1      ATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAG
XM_005257616.1      TTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAG
NM_139276.2         TTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAG
XM_005257618.1      TTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAG
NM_003150.3         TTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAG
XM_005257617.1      TTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         AAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTG
XM_005257616.1      AAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTG
NM_139276.2         AAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTG
XM_005257618.1      AAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTG
NM_003150.3         AAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTG
XM_005257617.1      AAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         AACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATC
XM_005257616.1      AACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATC
NM_139276.2         AACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATC
XM_005257618.1      AACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATC
NM_003150.3         AACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATC
XM_005257617.1      AACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         CTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAG
XM_005257616.1      CTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAG
NM_139276.2         CTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAG
XM_005257618.1      CTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAG
NM_003150.3         CTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAG
XM_005257617.1      CTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         TATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATAC
XM_005257616.1      TATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAG---GCGCTGCCCCATAC
NM_139276.2         TATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATAC
XM_005257618.1      TATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAG---GCGCTGCCCCATAC
NM_003150.3         TATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAG---GCGCTGCCCCATAC
XM_005257617.1      TATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATAC
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         CTGAAGACCAAGTTTATCTGTGTGACACCATT----------------------------
XM_005257616.1      CTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCG
NM_139276.2         CTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCG
XM_005257618.1      CTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCG
NM_003150.3         CTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCG
XM_005257617.1      CTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCG
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ----------------------CATTGATGCAGTTTGGAAATAA----------------
XM_005257616.1      ATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAA
NM_139276.2         ATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAA
XM_005257618.1      ATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAA
NM_003150.3         ATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAA
XM_005257617.1      ATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAA
                                                                                

HsCD00338451        ------------------------------------------------------------
NM_213662.1         ------------------------------------------------------------
XM_005257616.1      CCCTCAGCAGGAGGGCAGTTTGAGTCCCTCACCTTTGACATGGAGTTGACCTCGGAGTGC
NM_139276.2         CCCTCAGCAGGAGGGCAGTTTGAGTCCCTCACCTTTGACATGGAGTTGACCTCGGAGTGC
XM_005257618.1      CCCTCAGCAGGAGGGCAGTTTGAGTCCCTCACCTTTGACATGGAGTTGACCTCGGAGTGC
NM_003150.3         CCCTCAGCAGGAGGGCAGTTTGAGTCCCTCACCTTTGACATGGAGTTGACCTCGGAGTGC
XM_005257617.1      CCCTCAGCAGGAGGGCAGTTTGAGTCCCTCACCTTTGACATGGAGTTGACCTCGGAGTGC
                                                                                

HsCD00338451        ------------------
NM_213662.1         ------------------
XM_005257616.1      GCTACCTCCCCCATGTGA
NM_139276.2         GCTACCTCCCCCATGTGA
XM_005257618.1      GCTACCTCCCCCATGTGA
NM_003150.3         GCTACCTCCCCCATGTGA
XM_005257617.1      GCTACCTCCCCCATGTGA
                                      

Protein

SMART domain : STAT_int : STAT protein, protein interaction domain
Structural Annotation Wiki : TOPSAN
Swissprot ID : STAT3_HUMAN
HPRD : 00026

Clone

Cloning Information : 540153
HIP Master Clone ID : 450473
Original Clone ID : HR5535B-1-116-14.3

Experimental

TargetTrack - Experimental data : HR5535B

Organism


TAX_ID : 9606
Species Specific ID: None

Genome

Chromosome : 17
Map Location : 17q21.31
Ensembl : ENSG00000168610