DNASU Plasmid Repository • 480.965.5697 | Email

MAPK6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK6
Gene Name:  mitogen-activated protein kinase 6
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH147919.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000340

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2166nts         Open reading frame : 1 to 2166
Reference Sequence Alignment

ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
CTGCTTCCAGGAATTAGTCGAGAAGCAGTGGATTTCCTGGAACAAATTTTGACATTTAGC
CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
AACCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2644
Start on reference sequence 479
Mutations:
None
Discrepancy:
c868g,L290V
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK6
Symbol Nomenclature : MAPK6
SYNONYM : ERK3; HsT17250; PRKM6; p97MAPK
Designation : ERK-3|MAP kinase 6|MAP kinase isoform p97|MAPK 6|extracellular signal-regulated kinase 3|extracellular signal-regulated kinase, p97|p97-MAPK|protein kinase, mitogen-activated 5|protein kinase, mitogen-activated 6
Full Nomenclature : mitogen-activated protein kinase 6
GENEID : 5597
GI : 61365413
GenBank Accession : AY890763
HGNC : 6879
MIM : 602904
Vega : OTTHUMG00000131891
Target GenBank: NM_002748

 

Reference Sequence Alignment

  

HsCD00000340        ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
XM_005254537.1      ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
NM_002748.3         ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
XM_005254538.1      ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
                    ************************************************************

HsCD00000340        ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
XM_005254537.1      ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
NM_002748.3         ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
XM_005254538.1      ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
                    ************************************************************

HsCD00000340        GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
XM_005254537.1      GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
NM_002748.3         GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
XM_005254538.1      GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
                    ************************************************************

HsCD00000340        CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
XM_005254537.1      CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
NM_002748.3         CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
XM_005254538.1      CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
                    ************************************************************

HsCD00000340        TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
XM_005254537.1      TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
NM_002748.3         TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
XM_005254538.1      TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
                    ************************************************************

HsCD00000340        CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
XM_005254537.1      CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
NM_002748.3         CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
XM_005254538.1      CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
                    ************************************************************

HsCD00000340        CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
XM_005254537.1      CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
NM_002748.3         CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
XM_005254538.1      CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
                    ************************************************************

HsCD00000340        AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
XM_005254537.1      AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
NM_002748.3         AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
XM_005254538.1      AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
                    ************************************************************

HsCD00000340        AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
XM_005254537.1      AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
NM_002748.3         AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
XM_005254538.1      AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
                    ************************************************************

HsCD00000340        CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
XM_005254537.1      CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
NM_002748.3         CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
XM_005254538.1      CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
                    ************************************************************

HsCD00000340        CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
XM_005254537.1      CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
NM_002748.3         CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
XM_005254538.1      CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
                    ************************************************************

HsCD00000340        ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
XM_005254537.1      ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
NM_002748.3         ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
XM_005254538.1      ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
                    ************************************************************

HsCD00000340        ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
XM_005254537.1      ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
NM_002748.3         ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
XM_005254538.1      ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
                    ************************************************************

HsCD00000340        AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
XM_005254537.1      AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
NM_002748.3         AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
XM_005254538.1      AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
                    ************************************************************

HsCD00000340        CTGCTTCCAGGAATTAGTCGAGAAGCAGTGGATTTCCTGGAACAAATTTTGACATTTAGC
XM_005254537.1      CTGCTTCCAGGAATTAGTCGAGAAGCACTGGATTTCCTGGAACAAATTTTGACATTTAGC
NM_002748.3         CTGCTTCCAGGAATTAGTCGAGAAGCACTGGATTTCCTGGAACAAATTTTGACATTTAGC
XM_005254538.1      CTGCTTCCAGGAATTAGTCGAGAAGCACTGGATTTCCTGGAACAAATTTTGACATTTAGC
                    *************************** ********************************

HsCD00000340        CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
XM_005254537.1      CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
NM_002748.3         CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
XM_005254538.1      CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
                    ************************************************************

HsCD00000340        TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
XM_005254537.1      TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
NM_002748.3         TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
XM_005254538.1      TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
                    ************************************************************

HsCD00000340        ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
XM_005254537.1      ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
NM_002748.3         ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
XM_005254538.1      ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
                    ************************************************************

HsCD00000340        CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
XM_005254537.1      CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
NM_002748.3         CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
XM_005254538.1      CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
                    ************************************************************

HsCD00000340        GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
XM_005254537.1      GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
NM_002748.3         GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
XM_005254538.1      GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
                    ************************************************************

HsCD00000340        TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
XM_005254537.1      TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
NM_002748.3         TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
XM_005254538.1      TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
                    ************************************************************

HsCD00000340        ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
XM_005254537.1      ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
NM_002748.3         ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
XM_005254538.1      ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
                    ************************************************************

HsCD00000340        AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
XM_005254537.1      AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
NM_002748.3         AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
XM_005254538.1      AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
                    ************************************************************

HsCD00000340        GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
XM_005254537.1      GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
NM_002748.3         GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
XM_005254538.1      GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
                    ************************************************************

HsCD00000340        GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
XM_005254537.1      GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
NM_002748.3         GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
XM_005254538.1      GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
                    ************************************************************

HsCD00000340        GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
XM_005254537.1      GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
NM_002748.3         GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
XM_005254538.1      GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
                    ************************************************************

HsCD00000340        AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
XM_005254537.1      AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
NM_002748.3         AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
XM_005254538.1      AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
                    ************************************************************

HsCD00000340        CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
XM_005254537.1      CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
NM_002748.3         CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
XM_005254538.1      CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
                    ************************************************************

HsCD00000340        GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
XM_005254537.1      GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
NM_002748.3         GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
XM_005254538.1      GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
                    ************************************************************

HsCD00000340        AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
XM_005254537.1      AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
NM_002748.3         AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
XM_005254538.1      AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
                    ************************************************************

HsCD00000340        GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
XM_005254537.1      GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
NM_002748.3         GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
XM_005254538.1      GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
                    ************************************************************

HsCD00000340        AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
XM_005254537.1      AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
NM_002748.3         AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
XM_005254538.1      AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
                    ************************************************************

HsCD00000340        ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
XM_005254537.1      ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
NM_002748.3         ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
XM_005254538.1      ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
                    ************************************************************

HsCD00000340        TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
XM_005254537.1      TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
NM_002748.3         TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
XM_005254538.1      TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
                    ************************************************************

HsCD00000340        CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
XM_005254537.1      CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
NM_002748.3         CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
XM_005254538.1      CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
                    ************************************************************

HsCD00000340        GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
XM_005254537.1      GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
NM_002748.3         GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
XM_005254538.1      GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
                    ************************************************************

HsCD00000340        AACCTG
XM_005254537.1      AACTAA
NM_002748.3         AACTAA
XM_005254538.1      AACTAA
                    *** :.

Pathways

Panther : Alzheimer disease-amyloid secretase pathway
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Signal Transduction of S1P Receptor

Clone

Cloning Information : 147919
HIP Master Clone ID : 124238
Original Clone ID : FLH147919.01L

Organism


TAX_ID : 9606
Species Specific ID: 5597

Genome

Chromosome : 15
Map Location : 15q21
Ensembl : ENSG00000069956

Reagents

Labome : MAPK6-antibody