DNASU Plasmid Repository • 480.965.5697 | Email

STAT1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  STAT1
Gene Name:  signal transducer and activator of transcription 1, 91kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014048.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003428

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2139nts         Open reading frame : 1 to 2139
Reference Sequence Alignment

ATGTCTCAGTGGTACGAACTTCAGCAGCTTGACTCAAAATTCCTGGAGCAGGTTCACCAG
CTTTATGATGACAGTTTTCCCATGGAAATCAGACAGTACCTGGCACAGTGGTTAGAAAAG
CAAGACTGGGAGCACGCTGCCAATGATGTTTCATTTGCCACCATCCGTTTTCATGACCTC
CTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAG
CATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAG
ATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAG
AGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAA
GAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATC
AAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGA
GAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAG
AAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTG
CTGAATGTCACTGAACTTACCCAGAATGCCCTGATTAATGATGAACTAGTGGAGTGGAAG
CGGAGACAGCAGAGCGCCTGTATTGGGGGGCCGCCCAATGCTTGCTTGGATCAGCTGCAG
AACTGGTTCACTATAGTTGCGGAGAGTCTGCAGCAAGTTCGGCAGCAGCTTAAAAAGTTG
GAGGAATTGGAACAGAAATACACCTACGAACATGACCCTATCACAAAAAACAAACAAGTG
TTATGGGACCGCACCTTCAGTCTTTTCCAGCAGCTCATTCAGAGCTCGTTTGTGGTGGAA
AGACAGCCCTGCATGCCAACGCACCCTCAGAGGCCGCTGGTCTTGAAGACAGGGGTCCAG
TTCACTGTGAAGTTGAGACTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTGAAAGTC
AAAGTCTTATTTGATAAAGATGTGAATGAGAGAAATACAGTAAAAGGATTTAGGAAGTTC
AACATTTTGGGCACGCACACAAAAGTGATGAACATGGAGGAGTCCACCAATGGCAGTCTG
GCGGCTGAATTTCGGCACCTGCAATTGAAAGAACAGAAAAATGCTGGCACCAGAACGAAT
GAGGGTCCTCTCATCGTTACTGAAGAGCTTCACTCCCTTAGTTTTGAAACCCAATTGTGC
CAGCCTGGTTTGGTAATTGACCTCGAGACGACCTCTCTGCCCGTTGTGGTGATCTCCAAC
GTCAGCCAGCTCCCGAGCGGTTGGGCCTCCATCCTTTGGTACAACATGCTGGTGGCGGAA
CCCAGGAATCTGTCCTTCTTCCTGACTCCACCATGTGCACGATGGGCTCAGCTTTCAGAA
GTGCTGAGTTGGCAGTTTTCTTCTGTCACCAAAAGAGGTCTCAATGTGGACCAGCTGAAC
ATGTTGGGAGAGAAGCTTCTTGGTCCTAACGCCAGCCCCGATGGTCTCATTCCGTGGACG
AGGTTTTGTAAGGAAAATATAAATGATAAAAATTTTCCCTTCTGGCTTTGGATTGAAAGC
ATCCTAGAACTCATTAAAAAACACCTGCTCCCTCTCTGGAATGATGGGTGCATCATGGGC
TTCATCAGCAAGGAGCGAGAGCGTGCCCTGTTGAAGGACCAGCAGCCGGGGACCTTCCTG
CTGCGGTTCAGTGAGAGCTCCCGGGAAGGGGCCATCACATTCACATGGGTGGAGCGGTCC
CAGAACGGAGGCGAACCTGACTTCCATGCGGTTGAACCCTACACGAAGAAAGAACTTTCT
GCTGTTACTTTCCCTGACATCATTCGCAATTACAAAGTCATGGCTGCTGAGAATATTCCT
GAGAATCCCCTGAAGTATCTGTATCCAAATATTGACAAAGACCATGCCTTTGGAAAGTAT
TACTCCAGGCCAAAGGAAGCACCAGAGCCAATGGAACTTGATGGCCCTAAAGGAACTGGA
TATATCAAGACTGAGTTGATTTCTGTGTCTGAAGTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2454
Start on reference sequence 316
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : STAT1
Symbol Nomenclature : STAT1
SYNONYM : CANDF7; ISGF-3; STAT91
Designation : signal transducer and activator of transcription 1-alpha/beta|signal transducer and activator of transcription-1|transcription factor ISGF-3 components p91/p84
Full Nomenclature : signal transducer and activator of transcription 1, 91kDa
GENEID : 6772
GI : 60652664
GenBank Accession : AY892110
HGNC : 11362
MIM : 600555
Vega : OTTHUMG00000132699
Target GenBank: BC002704

 

Reference Sequence Alignment

  

HsCD00003428      ATGTCTCAGTGGTACGAACTTCAGCAGCTTGACTCAAAATTCCTGGAGCAGGTTCACCAG
NM_139266.2       ATGTCTCAGTGGTACGAACTTCAGCAGCTTGACTCAAAATTCCTGGAGCAGGTTCACCAG
NM_007315.3       ATGTCTCAGTGGTACGAACTTCAGCAGCTTGACTCAAAATTCCTGGAGCAGGTTCACCAG
                  ************************************************************

HsCD00003428      CTTTATGATGACAGTTTTCCCATGGAAATCAGACAGTACCTGGCACAGTGGTTAGAAAAG
NM_139266.2       CTTTATGATGACAGTTTTCCCATGGAAATCAGACAGTACCTGGCACAGTGGTTAGAAAAG
NM_007315.3       CTTTATGATGACAGTTTTCCCATGGAAATCAGACAGTACCTGGCACAGTGGTTAGAAAAG
                  ************************************************************

HsCD00003428      CAAGACTGGGAGCACGCTGCCAATGATGTTTCATTTGCCACCATCCGTTTTCATGACCTC
NM_139266.2       CAAGACTGGGAGCACGCTGCCAATGATGTTTCATTTGCCACCATCCGTTTTCATGACCTC
NM_007315.3       CAAGACTGGGAGCACGCTGCCAATGATGTTTCATTTGCCACCATCCGTTTTCATGACCTC
                  ************************************************************

HsCD00003428      CTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAG
NM_139266.2       CTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAG
NM_007315.3       CTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAG
                  ************************************************************

HsCD00003428      CATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAG
NM_139266.2       CATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAG
NM_007315.3       CATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAG
                  ************************************************************

HsCD00003428      ATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAG
NM_139266.2       ATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAG
NM_007315.3       ATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAG
                  ************************************************************

HsCD00003428      AGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAA
NM_139266.2       AGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAA
NM_007315.3       AGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAA
                  ************************************************************

HsCD00003428      GAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATC
NM_139266.2       GAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATC
NM_007315.3       GAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATC
                  ************************************************************

HsCD00003428      AAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGA
NM_139266.2       AAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGA
NM_007315.3       AAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGA
                  ************************************************************

HsCD00003428      GAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAG
NM_139266.2       GAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAG
NM_007315.3       GAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAG
                  ************************************************************

HsCD00003428      AAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTG
NM_139266.2       AAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTG
NM_007315.3       AAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTG
                  ************************************************************

HsCD00003428      CTGAATGTCACTGAACTTACCCAGAATGCCCTGATTAATGATGAACTAGTGGAGTGGAAG
NM_139266.2       CTGAATGTCACTGAACTTACCCAGAATGCCCTGATTAATGATGAACTAGTGGAGTGGAAG
NM_007315.3       CTGAATGTCACTGAACTTACCCAGAATGCCCTGATTAATGATGAACTAGTGGAGTGGAAG
                  ************************************************************

HsCD00003428      CGGAGACAGCAGAGCGCCTGTATTGGGGGGCCGCCCAATGCTTGCTTGGATCAGCTGCAG
NM_139266.2       CGGAGACAGCAGAGCGCCTGTATTGGGGGGCCGCCCAATGCTTGCTTGGATCAGCTGCAG
NM_007315.3       CGGAGACAGCAGAGCGCCTGTATTGGGGGGCCGCCCAATGCTTGCTTGGATCAGCTGCAG
                  ************************************************************

HsCD00003428      AACTGGTTCACTATAGTTGCGGAGAGTCTGCAGCAAGTTCGGCAGCAGCTTAAAAAGTTG
NM_139266.2       AACTGGTTCACTATAGTTGCGGAGAGTCTGCAGCAAGTTCGGCAGCAGCTTAAAAAGTTG
NM_007315.3       AACTGGTTCACTATAGTTGCGGAGAGTCTGCAGCAAGTTCGGCAGCAGCTTAAAAAGTTG
                  ************************************************************

HsCD00003428      GAGGAATTGGAACAGAAATACACCTACGAACATGACCCTATCACAAAAAACAAACAAGTG
NM_139266.2       GAGGAATTGGAACAGAAATACACCTACGAACATGACCCTATCACAAAAAACAAACAAGTG
NM_007315.3       GAGGAATTGGAACAGAAATACACCTACGAACATGACCCTATCACAAAAAACAAACAAGTG
                  ************************************************************

HsCD00003428      TTATGGGACCGCACCTTCAGTCTTTTCCAGCAGCTCATTCAGAGCTCGTTTGTGGTGGAA
NM_139266.2       TTATGGGACCGCACCTTCAGTCTTTTCCAGCAGCTCATTCAGAGCTCGTTTGTGGTGGAA
NM_007315.3       TTATGGGACCGCACCTTCAGTCTTTTCCAGCAGCTCATTCAGAGCTCGTTTGTGGTGGAA
                  ************************************************************

HsCD00003428      AGACAGCCCTGCATGCCAACGCACCCTCAGAGGCCGCTGGTCTTGAAGACAGGGGTCCAG
NM_139266.2       AGACAGCCCTGCATGCCAACGCACCCTCAGAGGCCGCTGGTCTTGAAGACAGGGGTCCAG
NM_007315.3       AGACAGCCCTGCATGCCAACGCACCCTCAGAGGCCGCTGGTCTTGAAGACAGGGGTCCAG
                  ************************************************************

HsCD00003428      TTCACTGTGAAGTTGAGACTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTGAAAGTC
NM_139266.2       TTCACTGTGAAGTTGAGACTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTGAAAGTC
NM_007315.3       TTCACTGTGAAGTTGAGACTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTGAAAGTC
                  ************************************************************

HsCD00003428      AAAGTCTTATTTGATAAAGATGTGAATGAGAGAAATACAGTAAAAGGATTTAGGAAGTTC
NM_139266.2       AAAGTCTTATTTGATAAAGATGTGAATGAGAGAAATACAGTAAAAGGATTTAGGAAGTTC
NM_007315.3       AAAGTCTTATTTGATAAAGATGTGAATGAGAGAAATACAGTAAAAGGATTTAGGAAGTTC
                  ************************************************************

HsCD00003428      AACATTTTGGGCACGCACACAAAAGTGATGAACATGGAGGAGTCCACCAATGGCAGTCTG
NM_139266.2       AACATTTTGGGCACGCACACAAAAGTGATGAACATGGAGGAGTCCACCAATGGCAGTCTG
NM_007315.3       AACATTTTGGGCACGCACACAAAAGTGATGAACATGGAGGAGTCCACCAATGGCAGTCTG
                  ************************************************************

HsCD00003428      GCGGCTGAATTTCGGCACCTGCAATTGAAAGAACAGAAAAATGCTGGCACCAGAACGAAT
NM_139266.2       GCGGCTGAATTTCGGCACCTGCAATTGAAAGAACAGAAAAATGCTGGCACCAGAACGAAT
NM_007315.3       GCGGCTGAATTTCGGCACCTGCAATTGAAAGAACAGAAAAATGCTGGCACCAGAACGAAT
                  ************************************************************

HsCD00003428      GAGGGTCCTCTCATCGTTACTGAAGAGCTTCACTCCCTTAGTTTTGAAACCCAATTGTGC
NM_139266.2       GAGGGTCCTCTCATCGTTACTGAAGAGCTTCACTCCCTTAGTTTTGAAACCCAATTGTGC
NM_007315.3       GAGGGTCCTCTCATCGTTACTGAAGAGCTTCACTCCCTTAGTTTTGAAACCCAATTGTGC
                  ************************************************************

HsCD00003428      CAGCCTGGTTTGGTAATTGACCTCGAGACGACCTCTCTGCCCGTTGTGGTGATCTCCAAC
NM_139266.2       CAGCCTGGTTTGGTAATTGACCTCGAGACGACCTCTCTGCCCGTTGTGGTGATCTCCAAC
NM_007315.3       CAGCCTGGTTTGGTAATTGACCTCGAGACGACCTCTCTGCCCGTTGTGGTGATCTCCAAC
                  ************************************************************

HsCD00003428      GTCAGCCAGCTCCCGAGCGGTTGGGCCTCCATCCTTTGGTACAACATGCTGGTGGCGGAA
NM_139266.2       GTCAGCCAGCTCCCGAGCGGTTGGGCCTCCATCCTTTGGTACAACATGCTGGTGGCGGAA
NM_007315.3       GTCAGCCAGCTCCCGAGCGGTTGGGCCTCCATCCTTTGGTACAACATGCTGGTGGCGGAA
                  ************************************************************

HsCD00003428      CCCAGGAATCTGTCCTTCTTCCTGACTCCACCATGTGCACGATGGGCTCAGCTTTCAGAA
NM_139266.2       CCCAGGAATCTGTCCTTCTTCCTGACTCCACCATGTGCACGATGGGCTCAGCTTTCAGAA
NM_007315.3       CCCAGGAATCTGTCCTTCTTCCTGACTCCACCATGTGCACGATGGGCTCAGCTTTCAGAA
                  ************************************************************

HsCD00003428      GTGCTGAGTTGGCAGTTTTCTTCTGTCACCAAAAGAGGTCTCAATGTGGACCAGCTGAAC
NM_139266.2       GTGCTGAGTTGGCAGTTTTCTTCTGTCACCAAAAGAGGTCTCAATGTGGACCAGCTGAAC
NM_007315.3       GTGCTGAGTTGGCAGTTTTCTTCTGTCACCAAAAGAGGTCTCAATGTGGACCAGCTGAAC
                  ************************************************************

HsCD00003428      ATGTTGGGAGAGAAGCTTCTTGGTCCTAACGCCAGCCCCGATGGTCTCATTCCGTGGACG
NM_139266.2       ATGTTGGGAGAGAAGCTTCTTGGTCCTAACGCCAGCCCCGATGGTCTCATTCCGTGGACG
NM_007315.3       ATGTTGGGAGAGAAGCTTCTTGGTCCTAACGCCAGCCCCGATGGTCTCATTCCGTGGACG
                  ************************************************************

HsCD00003428      AGGTTTTGTAAGGAAAATATAAATGATAAAAATTTTCCCTTCTGGCTTTGGATTGAAAGC
NM_139266.2       AGGTTTTGTAAGGAAAATATAAATGATAAAAATTTTCCCTTCTGGCTTTGGATTGAAAGC
NM_007315.3       AGGTTTTGTAAGGAAAATATAAATGATAAAAATTTTCCCTTCTGGCTTTGGATTGAAAGC
                  ************************************************************

HsCD00003428      ATCCTAGAACTCATTAAAAAACACCTGCTCCCTCTCTGGAATGATGGGTGCATCATGGGC
NM_139266.2       ATCCTAGAACTCATTAAAAAACACCTGCTCCCTCTCTGGAATGATGGGTGCATCATGGGC
NM_007315.3       ATCCTAGAACTCATTAAAAAACACCTGCTCCCTCTCTGGAATGATGGGTGCATCATGGGC
                  ************************************************************

HsCD00003428      TTCATCAGCAAGGAGCGAGAGCGTGCCCTGTTGAAGGACCAGCAGCCGGGGACCTTCCTG
NM_139266.2       TTCATCAGCAAGGAGCGAGAGCGTGCCCTGTTGAAGGACCAGCAGCCGGGGACCTTCCTG
NM_007315.3       TTCATCAGCAAGGAGCGAGAGCGTGCCCTGTTGAAGGACCAGCAGCCGGGGACCTTCCTG
                  ************************************************************

HsCD00003428      CTGCGGTTCAGTGAGAGCTCCCGGGAAGGGGCCATCACATTCACATGGGTGGAGCGGTCC
NM_139266.2       CTGCGGTTCAGTGAGAGCTCCCGGGAAGGGGCCATCACATTCACATGGGTGGAGCGGTCC
NM_007315.3       CTGCGGTTCAGTGAGAGCTCCCGGGAAGGGGCCATCACATTCACATGGGTGGAGCGGTCC
                  ************************************************************

HsCD00003428      CAGAACGGAGGCGAACCTGACTTCCATGCGGTTGAACCCTACACGAAGAAAGAACTTTCT
NM_139266.2       CAGAACGGAGGCGAACCTGACTTCCATGCGGTTGAACCCTACACGAAGAAAGAACTTTCT
NM_007315.3       CAGAACGGAGGCGAACCTGACTTCCATGCGGTTGAACCCTACACGAAGAAAGAACTTTCT
                  ************************************************************

HsCD00003428      GCTGTTACTTTCCCTGACATCATTCGCAATTACAAAGTCATGGCTGCTGAGAATATTCCT
NM_139266.2       GCTGTTACTTTCCCTGACATCATTCGCAATTACAAAGTCATGGCTGCTGAGAATATTCCT
NM_007315.3       GCTGTTACTTTCCCTGACATCATTCGCAATTACAAAGTCATGGCTGCTGAGAATATTCCT
                  ************************************************************

HsCD00003428      GAGAATCCCCTGAAGTATCTGTATCCAAATATTGACAAAGACCATGCCTTTGGAAAGTAT
NM_139266.2       GAGAATCCCCTGAAGTATCTGTATCCAAATATTGACAAAGACCATGCCTTTGGAAAGTAT
NM_007315.3       GAGAATCCCCTGAAGTATCTGTATCCAAATATTGACAAAGACCATGCCTTTGGAAAGTAT
                  ************************************************************

HsCD00003428      TACTCCAGGCCAAAGGAAGCACCAGAGCCAATGGAACTTGATGGCCCTAAAGGAACTGGA
NM_139266.2       TACTCCAGGCCAAAGGAAGCACCAGAGCCAATGGAACTTGATGGCCCTAAAGGAACTGGA
NM_007315.3       TACTCCAGGCCAAAGGAAGCACCAGAGCCAATGGAACTTGATGGCCCTAAAGGAACTGGA
                  ************************************************************

HsCD00003428      TATATCAAGACTGAGTTGATTTCTGTGTCTGAAGTGTTG---------------------
NM_139266.2       TATATCAAGACTGAGTTGATTTCTGTGTCTGAAGTGTAA---------------------
NM_007315.3       TATATCAAGACTGAGTTGATTTCTGTGTCTGAAGTTCACCCTTCTAGACTTCAGACCACA
                  ***********************************  :                      

HsCD00003428      ------------------------------------------------------------
NM_139266.2       ------------------------------------------------------------
NM_007315.3       GACAACCTGCTCCCCATGTCTCCTGAGGAGTTTGACGAGGTGTCTCGGATAGTGGGCTCT
                                                                              

HsCD00003428      ---------------------------------
NM_139266.2       ---------------------------------
NM_007315.3       GTAGAATTCGACAGTATGATGAACACAGTATAG
                                                   

Pathways

NCI : CXCR4-mediated signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPO signaling pathway
NCI : ErbB1 downstream signaling
NCI : FGF signaling pathway
NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : IFN-gamma pathway
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL27-mediated signaling events
NCI : IL6-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by TCPTP
NCI : TNF receptor signaling pathway
Panther : Angiogenesis
Panther : EGF receptor signaling pathway
Panther : Interferon-gamma signaling pathway
Panther : Interleukin signaling pathway
Panther : JAK/STAT signaling pathway
Panther : Oxidative stress response
Panther : PDGF signaling pathway
Panther : Ras Pathway
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Growth hormone receptor signaling
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interleukin-6 signaling
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Signal Transduction
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 fusion mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
WikiPathway : Adipogenesis
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : Endochondral Ossification
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : IL-9 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Type II interferon signaling (IFNG)
WikiPathway : p38 MAPK Signaling Pathway

Protein

SMART domain : STAT_int : STAT protein, protein interaction domain
UniProt : P42224
HPRD : 02777

Clone

Cloning Information : 14048
HIP Master Clone ID : 28247
Original Clone ID : FLH014048.01L

Organism


TAX_ID : 9606
Species Specific ID: 6772

Genome

Chromosome : 2
Map Location : 2q32.2
Ensembl : ENSG00000115415

Reagents

Labome : STAT1-antibody