DNASU Plasmid Repository • 480.965.5697 | Email

MAPK3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK3
Gene Name:  mitogen-activated protein kinase 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019087.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000343

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1140nts         Open reading frame : 1 to 1140
Reference Sequence Alignment

ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTC
GGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCG
CGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTAT
GACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACC
TACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTC
ATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATT
GTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAAT
GACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCC
AACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTT
AAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTC
CTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAG
GGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCT
AACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATC
CTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTAC
CTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGAC
TCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACA
GTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCA
GTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGCTG
AAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1151
Start on reference sequence 12
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK3
Symbol Nomenclature : MAPK3
SYNONYM : ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; P44ERK1; P44MAPK; PRKM3; p44-ERK1; p44-MAPK
Designation : MAP kinase isoform p44|MAPK 1|extracellular signal-regulated kinase 1|extracellular signal-related kinase 1|insulin-stimulated MAP2 kinase|microtubule-associated protein 2 kinase
Full Nomenclature : mitogen-activated protein kinase 3
GENEID : 5595
GI : 61355430
GenBank Accession : AY888192
HGNC : 6877
MIM : 601795
Vega : OTTHUMG00000132149
Target GenBank: BC013992

 

Reference Sequence Alignment

  

HsCD00000343        ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTC
NM_001040056.2      ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTC
NM_002746.2         ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTC
                    ************************************************************

HsCD00000343        GGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCG
NM_001040056.2      GGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCG
NM_002746.2         GGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCG
                    ************************************************************

HsCD00000343        CGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTAT
NM_001040056.2      CGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTAT
NM_002746.2         CGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTAT
                    ************************************************************

HsCD00000343        GACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACC
NM_001040056.2      GACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACC
NM_002746.2         GACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACC
                    ************************************************************

HsCD00000343        TACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTC
NM_001040056.2      TACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTC
NM_002746.2         TACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTC
                    ************************************************************

HsCD00000343        ATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATT
NM_001040056.2      ATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATT
NM_002746.2         ATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATT
                    ************************************************************

HsCD00000343        GTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAAT
NM_001040056.2      GTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAAT
NM_002746.2         GTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAAT
                    ************************************************************

HsCD00000343        GACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCC
NM_001040056.2      GACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCC
NM_002746.2         GACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCC
                    ************************************************************

HsCD00000343        AACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTT
NM_001040056.2      AACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTT
NM_002746.2         AACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTT
                    ************************************************************

HsCD00000343        AAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTC
NM_001040056.2      AAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTC
NM_002746.2         AAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTC
                    ************************************************************

HsCD00000343        CTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAG
NM_001040056.2      CTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAG
NM_002746.2         CTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAG
                    ************************************************************

HsCD00000343        GGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCT
NM_001040056.2      GGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCT
NM_002746.2         GGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCT
                    ************************************************************

HsCD00000343        AACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATC
NM_001040056.2      AACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATC
NM_002746.2         AACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATC
                    ************************************************************

HsCD00000343        CTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTAC
NM_001040056.2      CTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTAC
NM_002746.2         CTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTAC
                    ************************************************************

HsCD00000343        CTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGAC
NM_001040056.2      CTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGAC
NM_002746.2         CTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGAC
                    ************************************************************

HsCD00000343        TCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACA
NM_001040056.2      TCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACA
NM_002746.2         TCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACA
                    ************************************************************

HsCD00000343        GTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCA
NM_001040056.2      GTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGGTG
NM_002746.2         GTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCA
                    *********************************************************  .

HsCD00000343        GTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGCTG
NM_001040056.2      GG----------------------------------------------------------
NM_002746.2         GTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGCTG
                    *                                                           

HsCD00000343        AAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAG
NM_001040056.2      --------CCAGTCCCCAGCAGCAGTGGGGCTGGGGGCAGGGGAGCAGGGGGGCACGTAG
NM_002746.2         AAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAG
                            *.: * **..*...*** . *  *  .* *.**.*:**:**.** *.* ***

Pathways

NCI : ALK1 signaling events
NCI : ATF-2 transcription factor network
NCI : Alpha-synuclein signaling
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Arf6 downstream pathway
NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHB forward signaling
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : IFN-gamma pathway
NCI : IL2-mediated signaling events
NCI : Integrins in angiogenesis
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PDGFR-beta signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Telomerase
NCI : Regulation of cytoplasmic and nuclear SMAD2/3 signaling
NCI : Retinoic acid receptors-mediated signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : S1P1 pathway
NCI : S1P2 pathway
NCI : S1P3 pathway
NCI : S1P4 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-1-mediated signaling events
NCI : Syndecan-2-mediated signaling events
NCI : TRAIL signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : mTOR signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Interferon-gamma signaling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Parkinson disease
Panther : Ras Pathway
Panther : T cell activation
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : VEGF signaling pathway
Reactome : ARMS-mediated activation
Reactome : Activated TLR4 signalling
Reactome : Activation of the AP-1 family of transcription factors
Reactome : Advanced glycosylation endproduct receptor signaling
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Axon guidance
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : ERK activation
Reactome : ERK/MAPK targets
Reactome : ERK1 activation
Reactome : ERKs are inactivated
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Gene Expression
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interferon Signaling
Reactome : Interleukin-2 signaling
Reactome : L1CAM interactions
Reactome : M Phase
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : Platelet activation, signaling and aggregation
Reactome : Prolonged ERK activation events
Reactome : RAF/MAP kinase cascade
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Opening
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signal attenuation
Reactome : Signal transduction by L1
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Spry regulation of FGF signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcription
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : EPO Receptor Signaling
WikiPathway : FSH signaling pathway
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : IL-9 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Osteopontin Signaling
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 19087
HIP Master Clone ID : 33286
Original Clone ID : FLH019087.01X

Organism


TAX_ID : 9606
Species Specific ID: 5595

Genome

Chromosome : 16
Map Location : 16p11.2
Ensembl : ENSG00000102882

Reagents

Labome : ERK1-antibody