DNASU Plasmid Repository • 480.965.5697 | Email

YWHAE (Homo sapiens) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAE
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
Sequence             
Original Clone ID: NCI10277
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00343135

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 768nts         Open reading frame : 1 to 768
Reference Sequence Alignment

ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAE
Symbol Nomenclature : YWHAE
SYNONYM : 14-3-3E; HEL2; KCIP-1; MDCR; MDS
Designation : 14-3-3 epsilon|14-3-3 protein epsilon|epididymis luminal protein 2|mitochondrial import stimulation factor L subunit|protein kinase C inhibitor protein-1|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide|tyrosine 3/tryptophan 5 -monooxygenase activation protein, epsilon polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
GENEID : 7531
GI : 12655169
GenBank Accession : BC001440
HGNC : 12851
MIM : 605066
Vega : OTTHUMG00000134316
Target GenBank: BC001440

 

Reference Sequence Alignment

  

HsCD00343135        ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
XM_005256784.1      ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
NM_006761.4         ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
                    ************************************************************

HsCD00343135        GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
XM_005256784.1      GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
NM_006761.4         GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
                    ************************************************************

HsCD00343135        GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
XM_005256784.1      GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
NM_006761.4         GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
                    ************************************************************

HsCD00343135        AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
XM_005256784.1      AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
NM_006761.4         AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
                    ************************************************************

HsCD00343135        ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
XM_005256784.1      ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
NM_006761.4         ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
                    ************************************************************

HsCD00343135        CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
XM_005256784.1      CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
NM_006761.4         CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
                    ************************************************************

HsCD00343135        TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
XM_005256784.1      TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
NM_006761.4         TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
                    ************************************************************

HsCD00343135        AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
XM_005256784.1      AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
NM_006761.4         AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
                    ************************************************************

HsCD00343135        ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
XM_005256784.1      ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
NM_006761.4         ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
                    ************************************************************

HsCD00343135        TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
XM_005256784.1      TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
NM_006761.4         TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
                    ************************************************************

HsCD00343135        GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
XM_005256784.1      GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
NM_006761.4         GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
                    ************************************************************

HsCD00343135        ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
XM_005256784.1      ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGATTCC
NM_006761.4         ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
                    *******************************************************.* ..

HsCD00343135        GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGA
XM_005256784.1      TAA---------------------------------------------
NM_006761.4         GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGA
                     *.                                             

Pathways

NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : IGF1 pathway
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : PDGFR-beta signaling pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class II
NCI : TGF-beta receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
NCI : p75(NTR)-mediated signaling
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Apoptosis
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Centrosome maturation
Reactome : G2/M Transition
Reactome : HSF1 activation
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : Membrane Trafficking
Reactome : Mitotic G2-G2/M phases
Reactome : NADE modulates death signalling
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Signal Transduction
Reactome : Signaling by Hippo
Reactome : Signalling by NGF
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : P62258
HPRD : 05457

Clone

Cloning Information : 562491
HIP Master Clone ID : 472809
Original Clone ID : NCI10277

Organism


TAX_ID : 9606
Species Specific ID: 7531

Genome

Chromosome : 17
Map Location : 17p13.3
Ensembl : ENSG00000108953