DNASU Plasmid Repository • 480.965.5697 | Email

CKB (Homo sapiens) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CKB
Gene Name:  creatine kinase, brain
Sequence             
Original Clone ID: NCI10328
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00343148

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1146nts         Open reading frame : 1 to 1146
Reference Sequence Alignment

ATGCCCTTCTCCAACAGCCACAACGCACTGAAGCTGCGCTTCCCGGCCGAGGACGAGTTC
CCCGACCTGAGCGCCCACAACAACCACATGGCCAAGGTGCTGACCCCCGAGCTGTACGCG
GAGCTGCGCGCCAAGAGCACGCCGAGCGGCTTCACGCTGGACGACGTCATCCAGACAGGC
GTGGACAACCCGGGCCACCCGTACATCATGACCGTGGGCTGCGTGGCGGGCGACGAGGAG
TCCTACGAAGTGTTCAAGGATCTCTTCGACCCCATCATCGAGGACCGGCACGGCGGCTAC
AAGCCCAGCGATGAGCACAAGACCGACCTCAACCCCGACAACCTGCAGGGCGGCGACGAC
CTGGACCCCAACTACGTGCTGAGCTCGCGGGTGCGCACGGGCCGCAGCATCCGTGGCTTC
TGCCTCCCCCCGCACTGCAGCCGCGGGGAGCGCCGAGCCATCGAGAAGCTCGCGGTGGAA
GCCCTGTCCAGCCTGGACGGCGACCTGGCGGGCCGATACTACGCGCTCAAGAGCATGACG
GAGGCGGAGCAGCAGCAGCTCATCGACGACCACTTCCTCTTCGACAAGCCCGTGTCGCCC
CTGCTGCTGGCCTCGGGCATGGCCCGCGACTGGCCCGACGCCCGCGGTATCTGGCACAAT
GACAATAAGACCTTCCTGGTGTGGGTCAACGAGGAGGACCACCTGCGGGTCATCTCCATG
CAGAAGGGGGGCAACATGAAGGAGGTGTTCACCCGCTTCTGCACCGGCCTCACCCAGATT
GAAACTCTCTTCAAGTCTAAGGACTATGAGTTCATGTGGAACCCTCACCTGGGCTACATC
CTCACCTGCCCATCCAACCTGGGCACCGGGCTGCGGGCAGGTGTGCATATCAAGCTGCCC
AACCTGGGCAAGCATGAGAAGTTCTCGGAGGTGCTTAAGCGGCTGCGACTTCAGAAGCGA
GGCACAGGCGGTGTGGACACGGCTGCGGTGGGCGGGGTCTTCGACGTCTCCAACGCTGAC
CGCCTGGGCTTCTCAGAGGTGGAGCTGGTGCAGATGGTGGTGGACGGAGTGAAGCTGCTC
ATCGAGATGGAACAGCGGCTGGAGCAGGGCCAGGCCATCGACGACCTCATGCCTGCCCAG
AAATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CKB
Symbol Nomenclature : CKB
SYNONYM : B-CK; BCK; CKBB; HEL-S-29
Designation : creatine kinase B chain|creatine kinase B-type|creatine kinase-B|epididymis secretory protein Li 29
Full Nomenclature : creatine kinase, brain
GENEID : 1152
GI : 17939473
GenBank Accession : BC019281
HGNC : 1991
MIM : 123280
Vega : OTTHUMG00000171786
Target GenBank: BC019281

 

Reference Sequence Alignment

  

HsCD00343148      ATGCCCTTCTCCAACAGCCACAACGCACTGAAGCTGCGCTTCCCGGCCGAGGACGAGTTC
NM_001823.4       ATGCCCTTCTCCAACAGCCACAACGCACTGAAGCTGCGCTTCCCGGCCGAGGACGAGTTC
                  ************************************************************

HsCD00343148      CCCGACCTGAGCGCCCACAACAACCACATGGCCAAGGTGCTGACCCCCGAGCTGTACGCG
NM_001823.4       CCCGACCTGAGCGCCCACAACAACCACATGGCCAAGGTGCTGACCCCCGAGCTGTACGCG
                  ************************************************************

HsCD00343148      GAGCTGCGCGCCAAGAGCACGCCGAGCGGCTTCACGCTGGACGACGTCATCCAGACAGGC
NM_001823.4       GAGCTGCGCGCCAAGAGCACGCCGAGCGGCTTCACGCTGGACGACGTCATCCAGACAGGC
                  ************************************************************

HsCD00343148      GTGGACAACCCGGGCCACCCGTACATCATGACCGTGGGCTGCGTGGCGGGCGACGAGGAG
NM_001823.4       GTGGACAACCCGGGCCACCCGTACATCATGACCGTGGGCTGCGTGGCGGGCGACGAGGAG
                  ************************************************************

HsCD00343148      TCCTACGAAGTGTTCAAGGATCTCTTCGACCCCATCATCGAGGACCGGCACGGCGGCTAC
NM_001823.4       TCCTACGAAGTGTTCAAGGATCTCTTCGACCCCATCATCGAGGACCGGCACGGCGGCTAC
                  ************************************************************

HsCD00343148      AAGCCCAGCGATGAGCACAAGACCGACCTCAACCCCGACAACCTGCAGGGCGGCGACGAC
NM_001823.4       AAGCCCAGCGATGAGCACAAGACCGACCTCAACCCCGACAACCTGCAGGGCGGCGACGAC
                  ************************************************************

HsCD00343148      CTGGACCCCAACTACGTGCTGAGCTCGCGGGTGCGCACGGGCCGCAGCATCCGTGGCTTC
NM_001823.4       CTGGACCCCAACTACGTGCTGAGCTCGCGGGTGCGCACGGGCCGCAGCATCCGTGGCTTC
                  ************************************************************

HsCD00343148      TGCCTCCCCCCGCACTGCAGCCGCGGGGAGCGCCGAGCCATCGAGAAGCTCGCGGTGGAA
NM_001823.4       TGCCTCCCCCCGCACTGCAGCCGCGGGGAGCGCCGCGCCATCGAGAAGCTCGCGGTGGAA
                  ***********************************.************************

HsCD00343148      GCCCTGTCCAGCCTGGACGGCGACCTGGCGGGCCGATACTACGCGCTCAAGAGCATGACG
NM_001823.4       GCCCTGTCCAGCCTGGACGGCGACCTGGCGGGCCGATACTACGCGCTCAAGAGCATGACG
                  ************************************************************

HsCD00343148      GAGGCGGAGCAGCAGCAGCTCATCGACGACCACTTCCTCTTCGACAAGCCCGTGTCGCCC
NM_001823.4       GAGGCGGAGCAGCAGCAGCTCATCGACGACCACTTCCTCTTCGACAAGCCCGTGTCGCCC
                  ************************************************************

HsCD00343148      CTGCTGCTGGCCTCGGGCATGGCCCGCGACTGGCCCGACGCCCGCGGTATCTGGCACAAT
NM_001823.4       CTGCTGCTGGCCTCGGGCATGGCCCGCGACTGGCCCGACGCCCGCGGTATCTGGCACAAT
                  ************************************************************

HsCD00343148      GACAATAAGACCTTCCTGGTGTGGGTCAACGAGGAGGACCACCTGCGGGTCATCTCCATG
NM_001823.4       GACAATAAGACCTTCCTGGTGTGGGTCAACGAGGAGGACCACCTGCGGGTCATCTCCATG
                  ************************************************************

HsCD00343148      CAGAAGGGGGGCAACATGAAGGAGGTGTTCACCCGCTTCTGCACCGGCCTCACCCAGATT
NM_001823.4       CAGAAGGGGGGCAACATGAAGGAGGTGTTCACCCGCTTCTGCACCGGCCTCACCCAGATT
                  ************************************************************

HsCD00343148      GAAACTCTCTTCAAGTCTAAGGACTATGAGTTCATGTGGAACCCTCACCTGGGCTACATC
NM_001823.4       GAAACTCTCTTCAAGTCTAAGGACTATGAGTTCATGTGGAACCCTCACCTGGGCTACATC
                  ************************************************************

HsCD00343148      CTCACCTGCCCATCCAACCTGGGCACCGGGCTGCGGGCAGGTGTGCATATCAAGCTGCCC
NM_001823.4       CTCACCTGCCCATCCAACCTGGGCACCGGGCTGCGGGCAGGTGTGCATATCAAGCTGCCC
                  ************************************************************

HsCD00343148      AACCTGGGCAAGCATGAGAAGTTCTCGGAGGTGCTTAAGCGGCTGCGACTTCAGAAGCGA
NM_001823.4       AACCTGGGCAAGCATGAGAAGTTCTCGGAGGTGCTTAAGCGGCTGCGACTTCAGAAGCGA
                  ************************************************************

HsCD00343148      GGCACAGGCGGTGTGGACACGGCTGCGGTGGGCGGGGTCTTCGACGTCTCCAACGCTGAC
NM_001823.4       GGCACAGGCGGTGTGGACACGGCTGCGGTGGGCGGGGTCTTCGACGTCTCCAACGCTGAC
                  ************************************************************

HsCD00343148      CGCCTGGGCTTCTCAGAGGTGGAGCTGGTGCAGATGGTGGTGGACGGAGTGAAGCTGCTC
NM_001823.4       CGCCTGGGCTTCTCAGAGGTGGAGCTGGTGCAGATGGTGGTGGACGGAGTGAAGCTGCTC
                  ************************************************************

HsCD00343148      ATCGAGATGGAACAGCGGCTGGAGCAGGGCCAGGCCATCGACGACCTCATGCCTGCCCAG
NM_001823.4       ATCGAGATGGAGCAGCGGCTGGAGCAGGGCCAGGCCATCGACGACCTCATGCCTGCCCAG
                  ***********.************************************************

HsCD00343148      AAATGA
NM_001823.4       AAATGA
                  ******

Pathways

Reactome : Creatine metabolism
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
WikiPathway : Urea cycle and metabolism of amino groups

Protein

UniProt : P12277
HPRD : 00423

Clone

Cloning Information : 562506
HIP Master Clone ID : 472824
Original Clone ID : NCI10328

Organism


TAX_ID : 9606
Species Specific ID: 1152

Genome

Chromosome : 14
Map Location : 14q32
Ensembl : ENSG00000166165

Reagents

Labome : CKB-antibody