DNASU Plasmid Repository • 480.965.5697 | Email

SERPINB3 (Homo sapiens) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SERPINB3
Gene Name:  serpin peptidase inhibitor, clade B (ovalbumin), member 3
Sequence             
Original Clone ID: NCI10350
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 24560885
Title: Psoriasis pathogenesis Pso p27 is generated from SCCA1 with chymase
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00343153

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1173nts         Open reading frame : 1 to 1173
Reference Sequence Alignment

ATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGACCTGTTCCAACAGTTCAGA
AAATCAAAAGAGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATG
GTCCTCTTAGGAGCCAAAGACAACACTGCACAACAGATTAAGAAGGTTCTTCACTTTGAT
CAAGTCACAGAGAACACCACAGGAAAAGCTGCAACATATCATGTTGATAGGTCAGGAAAT
GTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAATCCACTGATGCATATGAG
CTGAAGATCGCCAACAAGCTCTTCGGAGAAAAAACGTATCTATTTTTACAGGAATATTTA
GATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTGTTGATTTTGCAAATGCTCCA
GAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAA
AACCTAATTCCTGAAGGTAATATTGGCAGCAATACCACATTGGTTCTTGTGAACGCAATC
TATTTCAAAGGGCAGTGGGAGAAGAAATTTAATAAAGAAGATACTAAAGAGGAAAAATTT
TGGCCAAACAAGAATACATACAAGTCCATACAGATGATGAGGCAATACACATCTTTTCAT
TTTGCCTCGCTGGAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGAT
CTAAGCATGATTGTGTTGCTGCCAAATGAAATCGATGGTCTCCAGAAGCTTGAAGAGAAA
CTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGACACGTGTC
GATTTACACTTACCTCGGTTCAAAGTGGAAGAGAGCTATGACCTCAAGGACACGTTGAGA
ACCATGGGAATGGTGGATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCGGGAGC
CGCGGTCTCGTGCTATCTGGAGTCCTACACAAGGCCTTTGTGGAGGTTACAGAGGAGGGA
GCAGAAGCTGCAGCTGCCACCGCTGTAGTAGGATTCGGATCATCACCTACTTCAACTAAT
GAAGAGTTCCATTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAATAAGACCAACAGC
ATCCTCTTCTATGGCAGATTCTCATCCCCGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SERPINB3
Symbol Nomenclature : SERPINB3
SYNONYM : HsT1196; SCC; SCCA-1; SCCA-PD; SCCA1; T4-A
Designation : protein T4-A|serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3|serpin B3|squamous cell carcinoma antigen 1
Full Nomenclature : serpin peptidase inhibitor, clade B (ovalbumin), member 3
GENEID : 6317
GI : 13528852
GenBank Accession : BC005224
HGNC : 10569
MIM : 600517
Vega : OTTHUMG00000060403
Target GenBank: BC005224

 

Reference Sequence Alignment

  

HsCD00343153      ATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGACCTGTTCCAACAGTTCAGA
NM_002974.2       ATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGATCTGTTCCAACAGTTCAGA
NM_006919.2       ATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGACCTGTTCCAACAGTTCAGA
                  ***************************************** ******************

HsCD00343153      AAATCAAAAGAGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATG
NM_002974.2       AAATCAAAAGAGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATG
NM_006919.2       AAATCAAAAGAGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATG
                  ************************************************************

HsCD00343153      GTCCTCTTAGGAGCCAAAGACAACACTGCACAACAGATTAAGAAGGTTCTTCACTTTGAT
NM_002974.2       GTCCTCTTAGGAGCCAAAGACAACACTGCACAACAAATTAGCAAGGTTCTTCACTTTGAT
NM_006919.2       GTCCTCTTAGGAGCCAAAGACAACACTGCACAACAGATTAAGAAGGTTCTTCACTTTGAT
                  ***********************************.****. ******************

HsCD00343153      CAAGTCACAGAGAACACCACAGGAAAAGCTGCAACATATCATGTTGATAGGTCAGGAAAT
NM_002974.2       CAAGTCACAGAGAACACCACAGAAAAAGCTGCAACATATCATGTTGATAGGTCAGGAAAT
NM_006919.2       CAAGTCACAGAGAACACCACAGGAAAAGCTGCAACATATCATGTTGATAGGTCAGGAAAT
                  **********************.*************************************

HsCD00343153      GTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAATCCACTGATGCATATGAG
NM_002974.2       GTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAATCCACTGATGCATATGAG
NM_006919.2       GTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAATCCACTGATGCATATGAG
                  ************************************************************

HsCD00343153      CTGAAGATCGCCAACAAGCTCTTCGGAGAAAAAACGTATCTATTTTTACAGGAATATTTA
NM_002974.2       CTGAAGATCGCCAACAAGCTCTTCGGAGAAAAGACGTATCAATTTTTACAGGAATATTTA
NM_006919.2       CTGAAGATCGCCAACAAGCTCTTCGGAGAAAAAACGTATCTATTTTTACAGGAATATTTA
                  ********************************.*******:*******************

HsCD00343153      GATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTGTTGATTTTGCAAATGCTCCA
NM_002974.2       GATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTACTGATTTTGCAAATGCTCCA
NM_006919.2       GATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTGTTGATTTTGCAAATGCTCCA
                  ***************************************. *******************

HsCD00343153      GAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAA
NM_002974.2       GAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAA
NM_006919.2       GAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAA
                  ************************************************************

HsCD00343153      AACCTAATTCCTGAAGGTAATATTGGCAGCAATACCACATTGGTTCTTGTGAACGCAATC
NM_002974.2       AACCTATTTCCTGATGGGACTATTGGCAATGATACGACACTGGTTCTTGTGAACGCAATC
NM_006919.2       AACCTAATTCCTGAAGGTAATATTGGCAGCAATACCACATTGGTTCTTGTGAACGCAATC
                  ******:*******:** *.********. .**** *** ********************

HsCD00343153      TATTTCAAAGGGCAGTGGGAGAAGAAATTTAATAAAGAAGATACTAAAGAGGAAAAATTT
NM_002974.2       TATTTCAAAGGGCAGTGGGAGAATAAATTTAAAAAAGAAAACACTAAAGAGGAAAAATTT
NM_006919.2       TATTTCAAAGGGCAGTGGGAGAAGAAATTTAATAAAGAAGATACTAAAGAGGAAAAATTT
                  *********************** ********:******.* ******************

HsCD00343153      TGGCCAAACAAGAATACATACAAGTCCATACAGATGATGAGGCAATACACATCTTTTCAT
NM_002974.2       TGGCCAAACAAGAATACATACAAATCTGTACAGATGATGAGGCAATACAATTCCTTTAAT
NM_006919.2       TGGCCAAACAAGAATACATACAAGTCCATACAGATGATGAGGCAATACACATCTTTTCAT
                  ***********************.** .*********************.:** ***.**

HsCD00343153      TTTGCCTCGCTGGAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGAT
NM_002974.2       TTTGCCTTGCTGGAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGAT
NM_006919.2       TTTGCCTCGCTGGAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGAT
                  ******* ****************************************************

HsCD00343153      CTAAGCATGATTGTGTTGCTGCCAAATGAAATCGATGGTCTCCAGAAGCTTGAAGAGAAA
NM_002974.2       CTAAGCATGATTGTGCTGCTGCCAAATGAAATCGATGGTCTGCAGAAGCTTGAAGAGAAA
NM_006919.2       CTAAGCATGATTGTGTTGCTGCCAAATGAAATCGATGGTCTCCAGAAGCTTGAAGAGAAA
                  *************** ************************* ******************

HsCD00343153      CTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGACACGTGTC
NM_002974.2       CTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGACATGTGTC
NM_006919.2       CTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGACACGTGTC
                  ****************************************************** *****

HsCD00343153      GATTTACACTTACCTCGGTTCAAAGTGGAAGAGAGCTATGACCTCAAGGACACGTTGAGA
NM_002974.2       GATTTACACTTACCTCGGTTCAAAATGGAAGAGAGCTATGACCTCAAGGACACGTTGAGA
NM_006919.2       GATTTACACTTACCTCGGTTCAAAGTGGAAGAGAGCTATGACCTCAAGGACACGTTGAGA
                  ************************.***********************************

HsCD00343153      ACCATGGGAATGGTGGATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCGGGAGC
NM_002974.2       ACCATGGGAATGGTGAATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCTGGAGC
NM_006919.2       ACCATGGGAATGGTGGATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCGGGAGC
                  ***************.************************************** *****

HsCD00343153      CGCGGTCTCGTGCTATCTGGAGTCCTACACAAGGCCTTTGTGGAGGTTACAGAGGAGGGA
NM_002974.2       CACGGTCTCTCAGTATCTAAAGTCCTACACAAGGCCTTTGTGGAGGTCACTGAGGAGGGA
NM_006919.2       CGCGGTCTCGTGCTATCTGGAGTCCTACACAAGGCCTTTGTGGAGGTTACAGAGGAGGGA
                  *.*******  . *****..*************************** **:*********

HsCD00343153      GCAGAAGCTGCAGCTGCCACCGCTGTAGTAGGATTCGGATCATCACCTACTTCAACTAAT
NM_002974.2       GTGGAAGCTGCAGCTGCCACCGCTGTAGTAGTAGTCGAATTATCATCTCCTTCAACTAAT
NM_006919.2       GCAGAAGCTGCAGCTGCCACCGCTGTAGTAGGATTCGGATCATCACCTACTTCAACTAAT
                  * .**************************** * ***.** **** **.***********

HsCD00343153      GAAGAGTTCCATTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAATAAGACCAACAGC
NM_002974.2       GAAGAGTTCTGTTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAATAAGACCAACAGC
NM_006919.2       GAAGAGTTCCATTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAATAAGACCAACAGC
                  ********* .*************************************************

HsCD00343153      ATCCTCTTCTATGGCAGATTCTCATCCCCGTAG
NM_002974.2       ATCCTCTTCTATGGCAGATTCTCATCCCCATAG
NM_006919.2       ATCCTCTTCTATGGCAGATTCTCATCCCCGTAG
                  *****************************.***

Protein

SMART domain : SERPIN : SERine Proteinase INhibitors
UniProt : P29508
HPRD : 02745

Clone

Cloning Information : 562511
HIP Master Clone ID : 472829
Original Clone ID : NCI10350

Organism


TAX_ID : 9606
Species Specific ID: 6317

Genome

Chromosome : 18
Map Location : 18q21.3
Ensembl : ENSG00000057149

Reagents

Labome : SERPINB3-antibody