DNASU Plasmid Repository • 480.965.5697 | Email

RAD52 (Homo sapiens) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAD52
Gene Name:  RAD52 homolog (S. cerevisiae)
Sequence             
Original Clone ID: NCI10468
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00343173

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1257nts         Open reading frame : 1 to 1257
Reference Sequence Alignment

ATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGC
GGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAG
AAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGC
CAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGT
TACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAAT
GGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATAT
CATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAG
AAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAAT
GCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGC
CAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTG
GAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAG
CAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGC
TCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGG
CAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCC
ACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACT
CCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAA
TTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGAT
GGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTG
AACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAA
GCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAAC
TGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAD52
Symbol Nomenclature : RAD52
SYNONYM : RP11-359B12.2
Designation : DNA repair protein RAD52 homolog|recombination protein RAD52|rhabdomyosarcoma antigen MU-RMS-40.23
Full Nomenclature : RAD52 homolog (S. cerevisiae)
GENEID : 5893
GI : 603157
GenBank Accession : U12134
HGNC : 9824
MIM : 600392
Vega : OTTHUMG00000090361
Target GenBank: U12134

 

Reference Sequence Alignment

  

HsCD00343173        ATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGC
NM_134424.2         ATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGC
XM_005253721.1      ATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGC
                    ************************************************************

HsCD00343173        GGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAG
NM_134424.2         GGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAG
XM_005253721.1      GGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAG
                    ************************************************************

HsCD00343173        AAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGC
NM_134424.2         AAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGC
XM_005253721.1      AAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGC
                    ************************************************************

HsCD00343173        CAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGT
NM_134424.2         CAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGT
XM_005253721.1      CAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGT
                    ************************************************************

HsCD00343173        TACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAAT
NM_134424.2         TACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAAT
XM_005253721.1      TACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAAT
                    ************************************************************

HsCD00343173        GGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATAT
NM_134424.2         GGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATAT
XM_005253721.1      GGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATAT
                    ************************************************************

HsCD00343173        CATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAG
NM_134424.2         CATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAG
XM_005253721.1      CATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAG
                    ************************************************************

HsCD00343173        AAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAAT
NM_134424.2         AAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAAT
XM_005253721.1      AAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAAT
                    ************************************************************

HsCD00343173        GCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGC
NM_134424.2         GCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGC
XM_005253721.1      GCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGC
                    ************************************************************

HsCD00343173        CAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTG
NM_134424.2         CAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTG
XM_005253721.1      CAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTG
                    ************************************************************

HsCD00343173        GAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAG
NM_134424.2         GAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAG
XM_005253721.1      GAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAG
                    ************************************************************

HsCD00343173        CAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGC
NM_134424.2         CAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGC
XM_005253721.1      CAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGC
                    ************************************************************

HsCD00343173        TCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGG
NM_134424.2         TCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGG
XM_005253721.1      TCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGG
                    ************************************************************

HsCD00343173        CAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCC
NM_134424.2         CAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCC
XM_005253721.1      CAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCC
                    ************************************************************

HsCD00343173        ACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACT
NM_134424.2         ACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACT
XM_005253721.1      ACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACT
                    ************************************************************

HsCD00343173        CCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAA
NM_134424.2         CCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAA
XM_005253721.1      CCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAA
                    ************************************************************

HsCD00343173        TTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGAT
NM_134424.2         TTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGAT
XM_005253721.1      TTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGAT
                    ************************************************************

HsCD00343173        GGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTG
NM_134424.2         GGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTG
XM_005253721.1      GGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTG
                    ************************************************************

HsCD00343173        AACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAA
NM_134424.2         AACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAA
XM_005253721.1      AACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAA
                    ************************************************************

HsCD00343173        GCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAAC
NM_134424.2         GCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAAC
XM_005253721.1      GCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAAC
                    ************************************************************

HsCD00343173        TGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAA
NM_134424.2         TGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAA
XM_005253721.1      TGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAA
                    *********************************************************

Pathways

Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : P43351
UniProt : Q3MI84
UniProt : Q5DR82
HPRD : 11855

Clone

Cloning Information : 562533
HIP Master Clone ID : 472851
Original Clone ID : NCI10468

Organism


TAX_ID : 9606
Species Specific ID: 5893

Genome

Chromosome : 12
Map Location : 12p13-p12.2
Ensembl : ENSG00000002016

Reagents

Labome : RAD52-antibody