DNASU Plasmid Repository • 480.965.5697 | Email

YWHAZ (Homo sapiens) in pMCSG19 (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAZ
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta
Sequence             
Original Clone ID: NCI10812
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG19               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00343205

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 747nts         Open reading frame : 1 to 747
Reference Sequence Alignment

TCCAATGCCATGGATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAG
CGATATGATGACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCC
AATGAGGAGAGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCA
TCTTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAG
ATGGCTCGAGAATACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTA
CTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTC
TATTTGAAAATGAAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGAC
AAGAAAGGGATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAA
AAGGAAATGCAACCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTC
TATTATGAGATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGAT
GAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATA
ATGCAATTACTGAGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCT
GAAGCAGGAGAAGGAGGGGAAAATTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19

pMCSG19 in advanced viewed

Synonyms: pMCSG-19
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV, His, TEV, NA; amp resistance; ligation independent cloning (LIC).
Comments: pMCSG7 derivative: in vivo TVMV cleavage of MBP
Size (bp): 6441
Parent Vector: None
Empty Vector: EvNO00084265
Properties: bacterial expression, improves solubility of insert, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 16497515
Title: An expression vector tailored for large-scale, high-throughput purification of recombinant proteins

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC Ligation independent cloning (LIC) site 204 235
bacterial origin ori ColE1-type bacterial origin of replication 4416 5098
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV protease cleavage site 286 306
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI coding sequence 2045 3004
selectable marker AmpR ampicillin resistance gene 5193 6053
tag His 2 C-terminal 6xHis tag 140 157
tag His 6xHis tag 268 285
tag MBP N-terminal MBP 337 1443
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAZ
Symbol Nomenclature : YWHAZ
SYNONYM : 14-3-3-zeta; HEL-S-3; HEL4; KCIP-1; YWHAD
Designation : 14-3-3 delta|14-3-3 protein zeta/delta|14-3-3 protein/cytosolic phospholipase A2|14-3-3 zeta|epididymis luminal protein 4|epididymis secretory protein Li 3|phospholipase A2|protein kinase C inhibitor protein 1|protein kinase C inhibitor protein-1|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide|tyrosine 3/tryptophan 5 -monooxygenase activation protein, zeta polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta
GENEID : 7534
GI : 68084347
GenBank Accession : BC003623
HGNC : 12855
MIM : 601288
Vega : OTTHUMG00000134291
Target GenBank: BC003623.2

 

Reference Sequence Alignment

  

HsCD00343205        ------------------------------------------------------------
XM_005251062.1      ------------------------------------------------------------
NM_001135701.1      ------------------------------------------------------------
NM_001135700.1      ------------------------------------------------------------
XM_005251063.1      ------------------------------------------------------------
NM_145690.2         ------------------------------------------------------------
NM_001135699.1      ------------------------------------------------------------
XM_005251061.1      ------------------------------------------------------------
NM_003406.3         ------------------------------------------------------------
NM_001135702.1      ------------------------------------------------------------
XM_005251060.1      ATGTTTCTCTCTGAACTTCCTGAAGTCAACTGGGCGGAGGCCCTACCGGTTCAGGCACCT
                                                                                

HsCD00343205        ------------------------------------------------------------
XM_005251062.1      ------------------------------------------------------------
NM_001135701.1      ------------------------------------------------------------
NM_001135700.1      ------------------------------------------------------------
XM_005251063.1      ------------------------------------------------------------
NM_145690.2         ------------------------------------------------------------
NM_001135699.1      ------------------------------------------------------------
XM_005251061.1      ------------------------------------------------------------
NM_003406.3         ------------------------------------------------------------
NM_001135702.1      ------------------------------------------------------------
XM_005251060.1      GCAATTTCCGCCTTTCTCCTTCCCCTTCTTCCGGGCTCCCGTCCCGGCTCATCACCCGGC
                                                                                

HsCD00343205        ------------------------------------------------------------
XM_005251062.1      ------------------------------------------------------------
NM_001135701.1      ------------------------------------------------------------
NM_001135700.1      ------------------------------------------------------------
XM_005251063.1      ------------------------------------------------------------
NM_145690.2         ------------------------------------------------------------
NM_001135699.1      ------------------------------------------------------------
XM_005251061.1      ------------------------------------------------------------
NM_003406.3         ------------------------------------------------------------
NM_001135702.1      ------------------------------------------------------------
XM_005251060.1      CTGTGGCCCACTCCCACCGCCAGCTGGAACCCTGGGGACTACGACGTCCCTCAAACCTTG
                                                                                

HsCD00343205        ------------------------------------------------------------
XM_005251062.1      ------------------------------------------------------------
NM_001135701.1      ------------------------------------------------------------
NM_001135700.1      ------------------------------------------------------------
XM_005251063.1      ------------------------------------------------------------
NM_145690.2         ------------------------------------------------------------
NM_001135699.1      ------------------------------------------------------------
XM_005251061.1      ------------------------------------------------------------
NM_003406.3         ------------------------------------------------------------
NM_001135702.1      ------------------------------------------------------------
XM_005251060.1      CTTCTAGGAGATAAAAAGGCCTCACCTCCTGCCGGCTCCGCCCGGCCCGGCCCACCTCGC
                                                                                

HsCD00343205        ------------------------------------------------------------
XM_005251062.1      ------------------------------------------------------------
NM_001135701.1      ------------------------------------------------------------
NM_001135700.1      ------------------------------------------------------------
XM_005251063.1      ------------------------------------------------------------
NM_145690.2         ------------------------------------------------------------
NM_001135699.1      ------------------------------------------------------------
XM_005251061.1      ------------------------------------------------------------
NM_003406.3         ------------------------------------------------------------
NM_001135702.1      ------------------------------------------------------------
XM_005251060.1      CCCCACCTCGGCGCCCACCCATTGTCCCCTCGCGCAGTCACCGAGCGCAGATCCCGCGCT
                                                                                

HsCD00343205        ------------------------------------------------------------
XM_005251062.1      ------------------------------------------------------------
NM_001135701.1      ------------------------------------------------------------
NM_001135700.1      ------------------------------------------------------------
XM_005251063.1      ------------------------------------------------------------
NM_145690.2         ------------------------------------------------------------
NM_001135699.1      ------------------------------------------------------------
XM_005251061.1      ------------------------------------------------------------
NM_003406.3         ------------------------------------------------------------
NM_001135702.1      ------------------------------------------------------------
XM_005251060.1      CTCGATTGGAACGCCTCCCCATCACTCAGCCACACTCAGGGGCTGGACGCCTCACTCCCG
                                                                                

HsCD00343205        ------------------------------------------------TCCAATGCCATG
XM_005251062.1      ---------------------------------------------------------ATG
NM_001135701.1      ---------------------------------------------------------ATG
NM_001135700.1      ---------------------------------------------------------ATG
XM_005251063.1      ---------------------------------------------------------ATG
NM_145690.2         ---------------------------------------------------------ATG
NM_001135699.1      ---------------------------------------------------------ATG
XM_005251061.1      ---------------------------------------------------------ATG
NM_003406.3         ---------------------------------------------------------ATG
NM_001135702.1      ---------------------------------------------------------ATG
XM_005251060.1      TTTCCGAGCCATAAAAGGTCTAGGACCGCTTCCCCCGAGCCAGCAGAACATCCAGTCATG
                                                                             ***

HsCD00343205        GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
XM_005251062.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
NM_001135701.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
NM_001135700.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
XM_005251063.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
NM_145690.2         GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
NM_001135699.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
XM_005251061.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
NM_003406.3         GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
NM_001135702.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
XM_005251060.1      GATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGAC
                    ************************************************************

HsCD00343205        ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
XM_005251062.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
NM_001135701.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
NM_001135700.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
XM_005251063.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
NM_145690.2         ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
NM_001135699.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
XM_005251061.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
NM_003406.3         ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
NM_001135702.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
XM_005251060.1      ATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG
                    ************************************************************

HsCD00343205        AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
XM_005251062.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
NM_001135701.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
NM_001135700.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
XM_005251063.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
NM_145690.2         AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
NM_001135699.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
XM_005251061.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
NM_003406.3         AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
NM_001135702.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
XM_005251060.1      AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTC
                    ************************************************************

HsCD00343205        GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
XM_005251062.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
NM_001135701.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
NM_001135700.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
XM_005251063.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
NM_145690.2         GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
NM_001135699.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
XM_005251061.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
NM_003406.3         GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
NM_001135702.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
XM_005251060.1      GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
                    ************************************************************

HsCD00343205        TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
XM_005251062.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
NM_001135701.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
NM_001135700.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
XM_005251063.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
NM_145690.2         TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
NM_001135699.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
XM_005251061.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
NM_003406.3         TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
NM_001135702.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
XM_005251060.1      TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTG
                    ************************************************************

HsCD00343205        GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
XM_005251062.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
NM_001135701.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
NM_001135700.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
XM_005251063.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
NM_145690.2         GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
NM_001135699.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
XM_005251061.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
NM_003406.3         GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
NM_001135702.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
XM_005251060.1      GAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG
                    ************************************************************

HsCD00343205        AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
XM_005251062.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
NM_001135701.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
NM_001135700.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
XM_005251063.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
NM_145690.2         AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
NM_001135699.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
XM_005251061.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
NM_003406.3         AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
NM_001135702.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
XM_005251060.1      AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATT
                    ************************************************************

HsCD00343205        GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
XM_005251062.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
NM_001135701.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
NM_001135700.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
XM_005251063.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
NM_145690.2         GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
NM_001135699.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
XM_005251061.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
NM_003406.3         GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
NM_001135702.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
XM_005251060.1      GTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAA
                    ************************************************************

HsCD00343205        CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
XM_005251062.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
NM_001135701.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
NM_001135700.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
XM_005251063.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
NM_145690.2         CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
NM_001135699.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
XM_005251061.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
NM_003406.3         CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
NM_001135702.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
XM_005251060.1      CCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATT
                    ************************************************************

HsCD00343205        CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
XM_005251062.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
NM_001135701.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
NM_001135700.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
XM_005251063.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
NM_145690.2         CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
NM_001135699.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
XM_005251061.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
NM_003406.3         CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
NM_001135702.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
XM_005251060.1      CTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT
                    ************************************************************

HsCD00343205        GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
XM_005251062.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
NM_001135701.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
NM_001135700.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
XM_005251063.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
NM_145690.2         GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
NM_001135699.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
XM_005251061.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
NM_003406.3         GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
NM_001135702.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
XM_005251060.1      GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
                    ************************************************************

HsCD00343205        AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
XM_005251062.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
NM_001135701.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
NM_001135700.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
XM_005251063.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
NM_145690.2         AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
NM_001135699.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
XM_005251061.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
NM_003406.3         AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
NM_001135702.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
XM_005251060.1      AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAA
                    ************************************************************

HsCD00343205        GGAGGGGAAAATTAA
XM_005251062.1      GGAGGGGAAAATTAA
NM_001135701.1      GGAGGGGAAAATTAA
NM_001135700.1      GGAGGGGAAAATTAA
XM_005251063.1      GGAGGGGAAAATTAA
NM_145690.2         GGAGGGGAAAATTAA
NM_001135699.1      GGAGGGGAAAATTAA
XM_005251061.1      GGAGGGGAAAATTAA
NM_003406.3         GGAGGGGAAAATTAA
NM_001135702.1      GGAGGGGAAAATTAA
XM_005251060.1      GGAGGGGAAAATTAA
                    ***************

Pathways

NCI : ATR signaling pathway
NCI : Alpha4 beta1 integrin signaling events
NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : GMCSF-mediated signaling events
NCI : IGF1 pathway
NCI : IL3-mediated signaling events
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : PI3 kinase pathway
Panther : Parkinson disease
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : Cytokine Signaling in Immune system
Reactome : GP1b-IX-V activation signalling
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Intrinsic Pathway for Apoptosis
Reactome : KSRP destabilizes mRNA
Reactome : Membrane Trafficking
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Platelet activation, signaling and aggregation
Reactome : Rap1 signalling
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : deactivation of the beta-catenin transactivating complex
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Prolactin Signaling Pathway

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : D0PNI1
UniProt : P63104
HPRD : 03183

Clone

Cloning Information : 562581
HIP Master Clone ID : 472899
Original Clone ID : NCI10812

Organism


TAX_ID : 9606
Species Specific ID: 7534

Genome

Chromosome : 8
Map Location : 8q23.1
Ensembl : ENSG00000164924