DNASU Plasmid Repository • 480.965.5697 | Email

NLRP4 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NLRP4
Gene Name:  NLR family, pyrin domain containing 4
Sequence             
Original Clone ID: HR3421D-7-99-14.1
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Northeast Structural Genomics Consortium
HsCD00343607

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 285nts         Open reading frame : 1 to 285
Reference Sequence Alignment

ATGTCTGATTTTGGTCTTATGTGGTATCTGGAGGAGCTCAAAAAGGAGGAGTTCAGGAAA
TTTAAAGAACATCTCAAGCAAATGACTTTGCAGCTTGAACTCAAGCAGATTCCCTGGACT
GAGGTCAAAAAAGCATCCCGGGAAGAACTTGCAAACCTCTTGATCAAGCACTATGAAGAA
CAACAAGCTTGGAACATAACCTTAAGAATCTTTCAAAAGATGGATAGAAAGGATCTCTGC
ATGAAGGTCATGAGGGAGAGAACAGGATACACAAAGACCTATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR3421D
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NLRP4
Symbol Nomenclature : NLRP4
SYNONYM : CLR19.5; CT58; NALP4; PAN2; PYPAF4; RNH2
Designation : NACHT, LRR and PYD containing protein 4|NACHT, LRR and PYD domains-containing protein 4|NACHT, leucine rich repeat and PYD containing 4|PAAD and NACHT-containing protein 2|PYRIN and NACHT-containing protein 2|PYRIN-containing APAF1-like protein 4|cancer/testis antigen 58|nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4|ribonuclease inhibitor 2
Full Nomenclature : NLR family, pyrin domain containing 4
GENEID : 147945
GI : 194018482
GenBank Accession : NM_134444
HGNC : 22943
MIM : 609645
Vega : OTTHUMG00000181734
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00343607      ---------------ATGTCTGATTTTGGTCTTATGTGGTATCTGGAGGAGCTCAAAAAG
NM_134444.4       ATGGCAGCCTCTTTCTTCTCTGATTTTGGTCTTATGTGGTATCTGGAGGAGCTCAAAAAG
                                 :* ******************************************

HsCD00343607      GAGGAGTTCAGGAAATTTAAAGAACATCTCAAGCAAATGACTTTGCAGCTTGAACTCAAG
NM_134444.4       GAGGAGTTCAGGAAATTTAAAGAACATCTCAAGCAAATGACTTTGCAGCTTGAACTCAAG
                  ************************************************************

HsCD00343607      CAGATTCCCTGGACTGAGGTCAAAAAAGCATCCCGGGAAGAACTTGCAAACCTCTTGATC
NM_134444.4       CAGATTCCCTGGACTGAGGTCAAAAAAGCATCCCGGGAAGAACTTGCAAACCTCTTGATC
                  ************************************************************

HsCD00343607      AAGCACTATGAAGAACAACAAGCTTGGAACATAACCTTAAGAATCTTTCAAAAGATGGAT
NM_134444.4       AAGCACTATGAAGAACAACAAGCTTGGAACATAACCTTAAGAATCTTTCAAAAGATGGAT
                  ************************************************************

HsCD00343607      AGAAAGGATCTCTGCATGAAGGTCATGAGGGAGAGAACAGGATACACAAAGACCTATTAG
NM_134444.4       AGAAAGGATCTCTGCATGAAGGTCATGAGGGAGAGAACAGGATACACAAAGACCTATCAA
                  ********************************************************* *.

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GCTCACGCAAAGCAGAAATTCAGCCGCTTATGGTCCAGCAAGTCTGTCACTGAGATTCAC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CTATACTTTGAGGAGGAAGTCAAGCAAGAAGAATGTGACCATTTGGACCGCCTTTTTGCT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CCCAAGGAAGCTGGGAAACAGCCACGTACAGTGATCATTCAAGGACCACAAGGAATTGGA
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AAAACGACACTCCTGATGAAGCTGATGATGGCCTGGTCGGACAACAAGATCTTTCGGGAT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AGGTTCCTGTACACGTTCTATTTCTGCTGCAGAGAACTGAGGGAGTTGCCGCCAACGAGT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TTGGCTGACTTGATTTCCAGAGAGTGGCCTGACCCCGCTGCTCCTATAACAGAGATCGTG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TCTCAACCGGAGAGACTCTTGTTCGTCATCGACAGCTTCGAAGAGCTGCAGGGCGGCTTG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AACGAACCCGATTCGGATCTGTGTGGTGACTTGATGGAGAAACGGCCGGTGCAGGTGCTT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CTGAGCAGTTTGCTGAGGAAGAAGATGCTCCCGGAGGCCTCCCTGCTCATCGCTATCAAA
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CCCGTGTGCCCGAAGGAGCTCCGGGATCAGGTGACGATCTCAGAAATCTACCAGCCCCGG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GGATTCAACGAGAGTGATAGGTTAGTGTATTTCTGCTGTTTCTTCAAAGACCCGAAAAGA
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GCCATGGAAGCCTTCAATCTTGTAAGAGAAAGTGAACAGCTGTTTTCCATATGCCAAATC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CCGCTCCTCTGCTGGATCCTGTGTACCAGTCTGAAGCAAGAGATGCAGAAAGGAAAAGAC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CTGGCCCTGACCTGCCAGAGCACTACCTCTGTGTACTCCTCTTTCGTCTTTAACCTGTTC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       ACACCTGAGGGTGCCGAGGGCCCGACTCCGCAAACCCAGCACCAGCTGAAGGCCCTGTGC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TCCCTGGCTGCAGAGGGTATGTGGACAGACACATTTGAGTTTTGTGAAGACGACCTCCGG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AGAAATGGGGTTGTTGACGCTGACATCCCTGCGCTGCTGGGCACCAAGATACTTCTGAAG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TACGGGGAGCGTGAGAGCTCCTACGTGTTCCTCCACGTGTGTATCCAGGAGTTCTGTGCC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GCCTTGTTCTATTTGCTCAAGAGCCACCTTGATCATCCTCACCCAGCTGTGAGATGTGTA
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CAGGAATTGCTAGTTGCCAATTTTGAAAAAGCAAGGAGAGCACATTGGATTTTTTTGGGG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TGTTTTCTAACTGGCCTTTTAAATAAAAAGGAACAAGAAAAACTGGATGCGTTTTTTGGC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TTCCAACTGTCCCAAGAGATAAAGCAGCAAATTCACCAGTGCCTGAAGAGCTTAGGGGAG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CGTGGCAATCCTCAGGGACAGGTGGATTCCTTGGCGATATTTTACTGTCTCTTTGAAATG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CAGGATCCTGCCTTTGTGAAGCAGGCAGTGAACCTCCTCCAAGAAGCTAACTTTCATATT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       ATTGACAACGTGGACTTGGTGGTTTCTGCCTACTGCTTAAAATACTGCTCCAGCTTGAGG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AAACTCTGTTTTTCCGTTCAAAATGTCTTTAAGAAAGAGGATGAACACAGCTCTACGTCG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GATTACAGCCTCATCTGTTGGCATCACATCTGCTCTGTGCTCACCACCAGCGGGCACCTC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AGAGAGCTCCAGGTGCAGGACAGCACCCTCAGCGAGTCGACCTTTGTGACCTGGTGTAAC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CAGCTGAGGCATCCCAGCTGTCGCCTTCAGAAGCTTGGAATAAATAACGTTTCCTTTTCT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GGCCAGAGTGTTCTGCTCTTTGAGGTGCTCTTTTATCAGCCAGACTTGAAATACCTGAGC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       TTCACCCTCACGAAACTCTCTCGTGATGACATCAGGTCCCTCTGTGATGCCTTGAACTAC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CCAGCAGGCAACGTCAAAGAGCTAGCGCTGGTAAATTGTCACCTCTCACCCATTGATTGT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GAAGTCCTTGCTGGCCTTCTAACCAACAACAAGAAGCTGACGTATCTGAATGTATCCTGC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AACCAGTTAGACACAGGCGTGCCCCTTTTGTGTGAAGCCCTGTGCAGCCCAGACACGGTC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CTGGTATACCTGATGTTGGCTTTCTGCCACCTCAGCGAGCAGTGCTGCGAATACATCTCT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GAAATGCTTCTGCGTAACAAGAGCGTGCGCTATCTAGACCTCAGTGCCAATGTCCTGAAG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GACGAAGGACTGAAAACTCTCTGCGAGGCCTTGAAACATCCGGACTGCTGCCTGGATTCA
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CTGTGTTTGGTAAAATGTTTTATCACTGCTGCTGGCTGTGAAGACCTCGCCTCTGCTCTC
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       ATCAGCAATCAAAACCTGAAGATTCTGCAAATTGGGTGCAATGAAATCGGAGATGTGGGT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GTGCAGCTGTTGTGTCGGGCTCTGACGCATACGGATTGCCGCTTAGAGATTCTTGGGTTG
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GAAGAATGTGGGTTAACGAGCACCTGCTGTAAGGATCTCGCGTCTGTTCTCACCTGCAGT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       AAGACCCTGCAGCAGCTCAACCTGACCTTGAACACCTTGGACCACACAGGGGTGGTTGTA
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       CTCTGTGAGGCCCTGAGACACCCAGAGTGTGCCCTGCAGGTGCTCGGGCTGAGAAAAACT
                                                                              

HsCD00343607      ------------------------------------------------------------
NM_134444.4       GATTTTGATGAGGAAACCCAGGCACTTCTGACGGCTGAGGAAGAGAGAAATCCTAACCTG
                                                                              

HsCD00343607      ---------------------------------------------
NM_134444.4       ACCATCACAGACGACTGTGACACAATCACAAGGGTAGAGATCTGA
                                                               

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : NOD pathway

Protein

Structural Annotation Wiki : TOPSAN
UniProt : Q96MN2
UniProt : B2RCA1
HPRD : 09619

Clone

Cloning Information : 534631
HIP Master Clone ID : 444951
Original Clone ID : HR3421D-7-99-14.1

Experimental

TargetTrack - Experimental data : HR3421D

Organism


TAX_ID : 9606
Species Specific ID: 147945

Genome

Chromosome : 19
Map Location : 19q13.43
Ensembl : ENSG00000160505

Reagents

Labome : NLRP4-antibody