DNASU Plasmid Repository • 480.965.5697 | Email

PA3200 (Pseudomonas aeruginosa PAO1) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PA3200
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: 9529e2BCt15p1
Keyword: None
Species: Pseudomonas aeruginosa PAO1
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
PaCD00344839

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 909nts         Open reading frame : 1 to 909

CGTGTCGATCTGCATTGCCACAGTACCGCCTCCGATGGCGTGCTCGCGCCCGCCGCCCTG
GTGCAGCGGGCCCACGAGAAAGGCGTCGGGCTGCTGGCGCTGACCGACCACGACACCCTG
GAGGGCCTGCCGGAAGCCCACCAGGCGGCCGCTCGACTCGGTATCGAACTGGTCAACGGT
GTCGAGCTGTCCTGCACCTGGGGCGGTGCCACCATTCATGTGCTGGGCTACGGTTTCGAC
CTCGACGCCGCTCCCCTGCGCCAGGCGACCGAAGCCCTGCACCGGGGCCGCTGGGCGCGC
GCCGAGGAAATCGACCGGCGGCTTACGGCCAAGGGTATGCCCGGTGCGCTGGAGGGCGCG
CGGGCGATCCAGCAGGCCTTGGGCGACAGCGGCAACGCGCCGGCGCGGCCGCATTTCGCC
GAGTTCCTGGTCCAGGGCGGCTGGGTCAAGGATCGCGCCGACGCGTTCCGCAAGTGGCTG
GGGGCCGGCAAGCTGGGAGACGTCAAGCAGCACTGGCCGACCCTGGAGGAAGTGGTCGGC
TGCCTGCGCGAGGCGCGCGCCTGGATCAGCCTGGCGCACCCGTATCATTATGATTTCACC
CGGACCAAGCGCCGGCGCCTGGTCGCCGACTTTCTCCAGGCCGGCGGACACGCCATCGAG
GTGGTCAATGGCGTGCAGCCGGCCGAACAGGTCGGTACCCTGTCGATCCTGGCCCGCGAG
TTCGGCCTGATGGTCACCGCCGGCAGCGATTTCCACGCGCCGGGCGACTGGTCCGAACTG
GGCATGTACCGTGCGGTTCCAGAGGACCTTCCGGCCATGTGGCCGCGTTTCGCCAGGCAT
TTTCGCGATACCGAACGTCATTCCGAAGCCAAGGGGGCCGAAGAAGGGCATCATCACCAT
CACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a123g,E41E;g325a,A109T
                                

5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-9529e
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : PA3200
GENEID : 882532
Locus Tag : PA3200
GI : 9949320
Target GenBank: None

 

Protein

SMART domain : POLIIIAc : DNA polymerase alpha chain like domain
Structural Annotation Wiki : TOPSAN
UniProt : Q9HZ40

Clone

Cloning Information : 561213
HIP Master Clone ID : 471531
Original Clone ID : 9529e2BCt15p1

Experimental

TargetTrack - Experimental data : NYSGXRC-9529e

Organism


TAX_ID : 208964
Species Specific ID: 882532

Reagents

Labome : PA3200-cDNA