DNASU Plasmid Repository • 480.965.5697 | Email

OPN1LW (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  OPN1LW
Gene Name:  opsin 1 (cone pigments), long-wave-sensitive
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100062150)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00350419

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1095nts         Open reading frame : 1 to 1095
Reference Sequence Alignment

ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
ATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTA
GCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTACTTCGTG
CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTGCAAGCCCTTTGGC
AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGTCT
GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
ATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGCTACCTC
CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCTGC
TGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCCTTCCAC
CCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
GTATCGCCTGCATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : OPN1LW
Symbol Nomenclature : OPN1LW
SYNONYM : CBBM; CBP; COD5; RCP; ROP
Designation : cone dystrophy 5 (X-linked)|long-wave-sensitive opsin 1|red cone photoreceptor pigment|red-sensitive opsin
Full Nomenclature : opsin 1 (cone pigments), long-wave-sensitive
GENEID : 5956
Locus Tag : hCG_41347
GenBank Accession : 563026
HGNC : 9936
MIM : 300822
Vega : OTTHUMG00000034295
Target GenBank: BC156643

 

Reference Sequence Alignment

  

HsCD00350419        ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
NM_020061.5         ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
NM_000513.2         ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
XM_003960089.2      ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
NM_001048181.2      ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
XM_005276725.1      ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAG
                    ************************************************************

HsCD00350419        GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
NM_020061.5         GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
NM_000513.2         GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
XM_003960089.2      GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
NM_001048181.2      GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
XM_005276725.1      GACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTC
                    ************************************************************

HsCD00350419        GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
NM_020061.5         GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
NM_000513.2         GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
XM_003960089.2      GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
NM_001048181.2      GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
XM_005276725.1      GAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATG
                    ************************************************************

HsCD00350419        ATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
NM_020061.5         ATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
NM_000513.2         ATCTTTGTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
XM_003960089.2      ATCTTTGTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
NM_001048181.2      ATCTTTGTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
XM_005276725.1      ATCTTTGTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAG
                    ************* **********************************************

HsCD00350419        TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTA
NM_020061.5         TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTA
NM_000513.2         TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTG
XM_003960089.2      TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTG
NM_001048181.2      TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTG
XM_005276725.1      TTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTG
                    ***********************************************************.

HsCD00350419        GCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTACTTCGTG
NM_020061.5         GCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTACTTCGTG
NM_000513.2         GCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTG
XM_003960089.2      GCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTG
NM_001048181.2      GCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTG
XM_005276725.1      GCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTG
                    ******************************.***************.*************

HsCD00350419        CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
NM_020061.5         CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
NM_000513.2         CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
XM_003960089.2      CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
NM_001048181.2      CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
XM_005276725.1      CTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
                    ************************************************************

HsCD00350419        CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTGCAAGCCCTTTGGC
NM_020061.5         CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGC
NM_000513.2         CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGC
XM_003960089.2      CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGC
NM_001048181.2      CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGC
XM_005276725.1      CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGC
                    ********************************.***.******* ***************

HsCD00350419        AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGTCT
NM_020061.5         AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCT
NM_000513.2         AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCT
XM_003960089.2      AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCT
NM_001048181.2      AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCT
XM_005276725.1      AATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCT
                    ********************************************************* **

HsCD00350419        GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
NM_020061.5         GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
NM_000513.2         GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
XM_003960089.2      GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
NM_001048181.2      GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
XM_005276725.1      GCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAG
                    ************************************************************

HsCD00350419        ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
NM_020061.5         ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
NM_000513.2         ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
XM_003960089.2      ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
NM_001048181.2      ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
XM_005276725.1      ACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATG
                    ************************************************************

HsCD00350419        ATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGCTACCTC
NM_020061.5         ATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGCTACCTC
NM_000513.2         ATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCATCATCGTGCTCTGCTACCTC
XM_003960089.2      ATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCATCATCGTGCTCTGCTACCTC
NM_001048181.2      ATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCATCATCGTGCTCTGCTACCTC
XM_005276725.1      ATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCATCATCGTGCTCTGCTACCTC
                    **************************** *******.  ******.**************

HsCD00350419        CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
NM_020061.5         CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
NM_000513.2         CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
XM_003960089.2      CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
NM_001048181.2      CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
XM_005276725.1      CAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAG
                    ************************************************************

HsCD00350419        AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCTGC
NM_020061.5         AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCTGC
NM_000513.2         AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC
XM_003960089.2      AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC
NM_001048181.2      AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC
XM_005276725.1      AAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC
                    ***************************************.** * **.*:**** *****

HsCD00350419        TGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCCTTCCAC
NM_020061.5         TGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCCTTCCAC
NM_000513.2         TGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCAC
XM_003960089.2      TGGGGACCCTACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCAC
NM_001048181.2      TGGGGACCCTACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCAC
XM_005276725.1      TGGGGACCCTACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCAC
                    ********.***.********************************** *** ********

HsCD00350419        CCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
NM_020061.5         CCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
NM_000513.2         CCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
XM_003960089.2      CCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
NM_001048181.2      CCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
XM_005276725.1      CCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTT
                    *************************:**********************************

HsCD00350419        ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
NM_020061.5         ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
NM_000513.2         ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
XM_003960089.2      ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
NM_001048181.2      ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
XM_005276725.1      ATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAG
                    ************************************************************

HsCD00350419        GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
NM_020061.5         GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
NM_000513.2         GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
XM_003960089.2      GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
NM_001048181.2      GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
XM_005276725.1      GTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCG
                    ************************************************************

HsCD00350419        GTATCGCCTGCATAA
NM_020061.5         GTATCGCCTGCATGA
NM_000513.2         GTATCGCCTGCATGA
XM_003960089.2      GTATCGCCTGCATGA
NM_001048181.2      GTATCGCCTGCATGA
XM_005276725.1      GTATCGCCTGCATGA
                    *************.*

Pathways

Reactome : Class A/1 (Rhodopsin-like receptors)
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : G alpha (i) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Opsins
Reactome : Retinoid cycle disease events
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : The retinoid cycle in cones (daylight vision)
Reactome : Visual phototransduction
WikiPathway : GPCRs, Class A Rhodopsin-like

Protein

UniProt : P04000
HPRD : 02366

Clone

Cloning Information : 563026

Organism


TAX_ID : 9606
Species Specific ID: 5956

Genome

Chromosome : X
Map Location : Xq28
Ensembl : ENSG00000102076

Reagents

Labome : OPN1LW-antibody