DNASU Plasmid Repository • 480.965.5697 | Email

IQSEC2 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IQSEC2
Gene Name:  IQ motif and Sec7 domain 2
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100062144)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00350499

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2850nts         Open reading frame : 1 to 2850
Reference Sequence Alignment

ATGGAGCCCCCCGGGAGGAGCAGCAGGTCCACAGCGTCTCATACTCTACACCAGTATTGC
TGTCCTACTCAGGTCCTTGACTCCATGAAGCTTACCCCCTCAGGCAGGCTGGCAGAGAGC
AGTGTGGAGGGTGATGCCCCAGGCAGTGACCTGAGCACAGCGGTTGATAGTCCTGGGAGC
CAACCCCCCTACCGGCTGAGCCAGCTGCCCCCCTCCAGCAGCCACATGGGGGGCCCCCCT
GCTGGAGTGGGCCTTCCCTGGGCTCAGCGGGCACGCCTCCAGCCAGCCAGTGTCGCCCTG
AGGAAGCAGGAGGAGGAGGAGATAAAGCGCTCCAAGGCCCTATCGGACAGCTATGAACTC
TCCACAGACCTGCAGGACAAGAAGGTGGAAATGCTGGAGAGGAAGTATGGGGGCTCCTTC
CTGAGCCGCAGGGCTGCCAGGACCATCCAGACAGCCTTCCGCCAGTACCGCATGAACAAG
AACTTTGAGCGGCTACGCAGCTCAGCCTCAGAGAGCCGCATGTCCCGCCGCATCATCCTT
TCCAACATGCGGATGCAGTTCTCCTTTGAGGAGTATGAGAAGGCACAGAACCCCGCGTAC
TTCGAGGGCAAGCCTGCCTCGCTGGACGAGGGTGCCATGGCTGGTGCCCGGAGCCACCGG
CTTGAACGGGGGCTCCCATATGGAGGCTCCTGTGGTGGGGGCATCGATGGTGGTGGAAGC
TCCGTCACCACATCTGGAGAGTTTTCTAATGACATCACAGAACTTGAGGACTCCTTCTCC
AAACAGGTAAAGTCTCTGGCTGAATCCATCGACGAAGCCCTGAACTGCCACCCGTCAGGG
CCCATGTCTGAGGAGCCAGGGTCAGCCCAGCTGGAGAAGCGGGAGTCAAAGGAACAGCAA
GAGGACAGCTCAGCCACATCCTTCAGTGATCTTCCCCTCTACCTGGATGACACAGTTCCC
CAACAATCCCCTGAGCGACTGCCCAGCACAGAACCCCCACCCCAGGGCCGGCCCGAGTTC
TGGGCGCCAGCCCCTCTCCCGCCAGTTCCTCCACCAGTGCCATCAGGAACCCGGGAAGAC
GGTAGCCGTGAGGAAGGCACTCGCAGGGGTCCCGGGTGCTTGGAGTGCCGGGATTTCCGG
CTGCGGGCTGCCCACCTTCCCCTGCTTACCATTGAGCCTCCTAGTGACAGCTCCGTGGAC
CTGAGTGACCGCTCAGATCGCGGCTCTGTCCACCGCCAGCTGGTGTATGAGGCTGATGGC
TGCAGCCCCCATGGGACCCTGAAGCACAAGGGGCCACCAGGCAGGGCCCCGATCCCACAC
CGCCACTACCCAGCCCCTGAAGGCCCAGCCCCAGCCCCACCAGGGCCCCTGCCACCAGCC
CCCAACAGTGGCACTGGGCCCAGTGGTGTGGCTGGGGGTCGGAGGTTGGGGAAGTGCGAG
GCAGCAGGCGAGAACTCTGATGGTGGAGATAACGAGAGCCTTGAGAGCTCCAGCAATTCC
AATGAGACCATCAACTGCAGCTCCGGCTCCTCTTCTCGGGACAGTCTAAGGGAGCCTCCG
GCTACCGGCCTGTGCAAGCAGACTTACCAGCGGGAGACAAGGCATAGCTGGGACTCGCCA
GCTTTCAACAATGATGTGGTCCAGAGGCGGCACTACCGAATCGGCCTCAACCTCTTCAAC
AAGAAGCCAGAGAAGGGTATCCAGTATCTGATCGAGCGGGGCTTCCTGTCAGACACACCG
GTGGGAGTGGCTCACTTCATCCTGGAGCGGAAAGGCCTCAGCCGGCAGATGATAGGGGAA
TTCCTAGGGAACCGGCAGAAGCAGTTCAACAGAGACGTGTTGGACTGTGTGGTGGATGAG
ATGGACTTCTCCTCCATGGATCTGGATGATGCGCTCCGGAAGTTCCAGTCCCATATCCGG
GTTCAGGGTGAGGCCCAGAAAGTGGAGCGACTCATCGAAGCCTTCAGCCAGCGGTACTGT
GTCTGTAACCCAGCCCTCGTGCGCCAGTTCCGGAACCCAGACACCATCTTCATCCTTGCT
TTTGCCATCATCCTCCTCAATACCGACATGTACAGTCCCAGCGTCAAAGCTGAACGAAAG
ATGAAACTAGATGACTTCATCAAGAACCTGAGAGGGGTTGACAATGGTGAAGACATCCCC
CGAGACCTCCTGGTGGGCATCTACCAGCGCATCCAGGGGCGTGAACTGCGGACCAACGAT
GACCATGTGTCCCAGGTGCAGGCTGTGGAGCGCATGATTGTTGGAAAGAAACCAGTCCTG
TCTCTCCCTCACCGTCGACTGGTTTGCTGCTGCCAGCTCTACGAGGTGCCAGATCCAAAC
CGCCCCCAGAGGCTAGGGTTGCATCAGCGGGAGGTCTTCCTCTTCAATGATCTCCTTGTG
GTCACCAAAATTTTCCAGAAGAAGAAGATCTTGGTGACGTACAGTTTCCGTCAGTCTTTC
CCCCTCGTGGAAATGCACATGCAGCTCTTCCAGAATTCATATTACCAGTTTGGGATCAAG
TTGCTGTCTGCAGTACCTGGTGGGGAGCGAAAAGTCCTCATCATCTTCAATGCCCCCAGC
CTCCAGGACCGGCTGCGCTTTACATCCGACCTGCGCGAGTCCATTGCGGAGGTGCAGGAG
ATGGAGAAATACCGTGTGGAGTCGGAGCTGGAGAAGCAGAAAGGTATGATGCGGCCTAAC
GCCTCACAGCCTGGAGGGGCCAAGGACTCAGTGAATGGGACGATGGCCCGCAGTAGCCTG
GAGGACACTTACGGGGCAGGCGATGGGCTCAAACGGGGCGCACTCAGCAGTTCCCTGCGA
GACCTCTCTGATGCAGGGGTCTGTTATTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IQSEC2
Symbol Nomenclature : IQSEC2
SYNONYM : BRAG1; MRX1
Designation : IQ motif and SEC7 domain-containing protein 2|brefeldin A resistant Arf-guanine nucleotide exchange factor 1|brefeldin A resistant Arf-guanine nucleotide exchange factor 1b|brefeldin A resistant Arf-guanine nucleotide exchange factor 1c|mental retardation, X-linked 1 (non-dysmorphic)
Full Nomenclature : IQ motif and Sec7 domain 2
GENEID : 23096
Locus Tag : RP11-258C19.1
GenBank Accession : 563106
HGNC : 29059
MIM : 300522
Vega : OTTHUMG00000021608
Target GenBank: BC156683

 

Reference Sequence Alignment

  

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      ATGGAGGCGGGGTCGGGGCCCCCGGGCGGCCCGGGATCCGAGAGCCCAAATCGGGCCGTG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      GAGTACCTGCTGGAGCTGAACAACATCATCGAGAGCCAGCAGCAGCTGCTGGAAACCCAG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CGGCGGCGCATCGAGGAGCTGGAGGGCCAGCTGGACCAGCTCACCCAGGAGAACCGCGAC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CTGCGAGAGGAGAGCCAGCTGCACCGCGGGGAGCTGCACCGGGACCCCCACGGCGCGCGG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      GATAGCCCGGGCCGCGAGAGCCAGTACCAGAACCTGCGCGAGACCCAGTTCCACCACCGC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      GAGCTGCGGGAGAGCCAGTTCCACCAGGCGGCCCGGGACGTGGGCTACCCGAACCGGGAA
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      GGCGCCTACCAGAATCGGGAGGCTGTGTATCGGGACAAGGAGCGGGACGCCTCCTACCCG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CTCCAGGACACTACCGGTTACACAGCCCGCGAGCGTGACGTGGCCCAGTGCCACCTGCAC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CACGAGAACCCAGCCCTGGGTCGCGAGCGTGGCGGGCGGGAGGCCGGGCCGGCGCACCCG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      GGCCGCGAGAAGGAAGCGGGCTATTCGGCGGCGGTGGGCGTGGGGCCGCGGCCACCGCGG
                                                                                

HsCD00350499        ---------------ATGGAGCCCCCCGGGAGGAGCAGCAGGTCCACAGCGTCTCATACT
NM_015075.1         ---------------ATGGAGCCCCCCGGGAGGAGCAGCAGGTCCACAGCGTCTCATACT
NM_001111125.2      GAGCGGGGCCAGCTGAGCCGTGGCGCATCCAGGAGCTCCAGTCCCGGCGCCGGCGGAGGC
                                   *   .   * *.   ******: ***  **. .**     .:.  

HsCD00350499        CTACACCAGTATTGCTGTCCTACTCAGGTCCTTGACTCCATGAAGCTTACCCCCTCAGGC
NM_015075.1         CTACACCAGTATTGCTGTCCTACTCAGGTCCTTGACTCCATGAAGCTTACCCCCTCAGGC
NM_001111125.2      CACAGCACCAGTACCAGCACCAGCCCGGCCACGACCCTCCAGAGAAAATCTGATGGTGAG
                    *:...*.. :.*: *:* .* *  *.** *.  ..*  *.:**...:::*  .   :*. 

HsCD00350499        AGGCTGGCAGAGAGCAGTGTGGAGGGTGATGCCCCAGGCAGTGACCTGAGCACAGCGGTT
NM_015075.1         AGGCTGGCAGAGAGCAGTGTGGAGGGTGATGCCCCAGGCAGTGACCTGAGCACAGCGGTT
NM_001111125.2      AATTCCAGAACAGTCAGTGTGGAGGGTGATGCCCCAGGCAGTGACCTGAGCACAGCGGTT
                    *.    . *.... **********************************************

HsCD00350499        GATAGTCCTGGGAGCCAACCCCCCTACCGGCTGAGCCAGCTGCCCCCCTCCAGCAGCCAC
NM_015075.1         GATAGTCCTGGGAGCCAACCCCCCTACCGGCTGAGCCAGCTGCCCCCCTCCAGCAGCCAC
NM_001111125.2      GATAGTCCTGGGAGCCAACCCCCCTACCGGCTGAGCCAGCTGCCCCCCTCCAGCAGCCAC
                    ************************************************************

HsCD00350499        ATGGGGGGCCCCCCTGCTGGAGTGGGCCTTCCCTGGGCTCAGCGGGCACGCCTCCAGCCA
NM_015075.1         ATGGGGGGCCCCCCTGCTGGAGTGGGCCTTCCCTGGGCTCAGCGGGCACGCCTCCAGCCA
NM_001111125.2      ATGGGGGGCCCCCCTGCTGGAGTGGGCCTTCCCTGGGCTCAGCGGGCACGCCTCCAGCCA
                    ************************************************************

HsCD00350499        GCCAGTGTCGCCCTGAGGAAGCAGGAGGAGGAGGAGATAAAGCGCTCCAAGGCCCTATCG
NM_015075.1         GCCAGTGTCGCCCTGAGGAAGCAGGAGGAGGAGGAGATAAAGCGCTCCAAGGCCCTATCG
NM_001111125.2      GCCAGTGTCGCCCTGAGGAAGCAGGAGGAGGAGGAGATAAAGCGCTCCAAGGCCCTATCG
                    ************************************************************

HsCD00350499        GACAGCTATGAACTCTCCACAGACCTGCAGGACAAGAAGGTGGAAATGCTGGAGAGGAAG
NM_015075.1         GACAGCTATGAACTCTCCACAGACCTGCAGGACAAGAAGGTGGAAATGCTGGAGAGGAAG
NM_001111125.2      GACAGCTATGAACTCTCCACAGACCTGCAGGACAAGAAGGTGGAAATGCTGGAGAGGAAG
                    ************************************************************

HsCD00350499        TATGGGGGCTCCTTCCTGAGCCGCAGGGCTGCCAGGACCATCCAGACAGCCTTCCGCCAG
NM_015075.1         TATGGGGGCTCCTTCCTGAGCCGCAGGGCTGCCAGGACCATCCAGACAGCCTTCCGCCAG
NM_001111125.2      TATGGGGGCTCCTTCCTGAGCCGCAGGGCTGCCAGGACCATCCAGACAGCCTTCCGCCAG
                    ************************************************************

HsCD00350499        TACCGCATGAACAAGAACTTTGAGCGGCTACGCAGCTCAGCCTCAGAGAGCCGCATGTCC
NM_015075.1         TACCGCATGAACAAGAACTTTGAGCGGCTACGCAGCTCAGCCTCAGAGAGCCGCATGTCC
NM_001111125.2      TACCGCATGAACAAGAACTTTGAGCGGCTACGCAGCTCAGCCTCAGAGAGCCGCATGTCC
                    ************************************************************

HsCD00350499        CGCCGCATCATCCTTTCCAACATGCGGATGCAGTTCTCCTTTGAGGAGTATGAGAAGGCA
NM_015075.1         CGCCGCATCATCCTTTCCAACATGCGGATGCAGTTCTCCTTTGAGGAGTATGAGAAGGCA
NM_001111125.2      CGCCGCATCATCCTTTCCAACATGCGGATGCAGTTCTCCTTTGAGGAGTATGAGAAGGCA
                    ************************************************************

HsCD00350499        CAGAACCCCGCGTACTTCGAGGGCAAGCCTGCCTCGCTGGACGAGGGTGCCATGGCTGGT
NM_015075.1         CAGAACCCCGCGTACTTCGAGGGCAAGCCTGCCTCGCTGGACGAGGGTGCCATGGCTGGT
NM_001111125.2      CAGAACCCCGCGTACTTCGAGGGCAAGCCTGCCTCGCTGGACGAGGGTGCCATGGCTGGT
                    ************************************************************

HsCD00350499        GCCCGGAGCCACCGGCTTGAACGGGGGCTCCCATATGGAGGCTCCTGTGGTGGGGGCATC
NM_015075.1         GCCCGGAGCCACCGGCTTGAACGGGGGCTCCCATATGGAGGCTCCTGTGGTGGGGGCATC
NM_001111125.2      GCCCGGAGCCACCGGCTTGAACGGGGGCTCCCATATGGAGGCTCCTGTGGTGGGGGCATC
                    ************************************************************

HsCD00350499        GATGGTGGTGGAAGCTCCGTCACCACATCTGGAGAGTTTTCTAATGACATCACAGAACTT
NM_015075.1         GATGGTGGTGGAAGCTCCGTCACCACATCTGGAGAGTTTTCTAATGACATCACAGAACTT
NM_001111125.2      GATGGTGGTGGAAGCTCCGTCACCACATCTGGAGAGTTTTCTAATGACATCACAGAACTT
                    ************************************************************

HsCD00350499        GAGGACTCCTTCTCCAAACAGGTAAAGTCTCTGGCTGAATCCATCGACGAAGCCCTGAAC
NM_015075.1         GAGGACTCCTTCTCCAAACAGGTAAAGTCTCTGGCTGAATCCATCGACGAAGCCCTGAAC
NM_001111125.2      GAGGACTCCTTCTCCAAACAGGTAAAGTCTCTGGCTGAATCCATCGACGAAGCCCTGAAC
                    ************************************************************

HsCD00350499        TGCCACCCGTCAGGGCCCATGTCTGAGGAGCCAGGGTCAGCCCAGCTGGAGAAGCGGGAG
NM_015075.1         TGCCACCCGTCAGGGCCCATGTCTGAGGAGCCAGGGTCAGCCCAGCTGGAGAAGCGGGAG
NM_001111125.2      TGCCACCCGTCAGGGCCCATGTCTGAGGAGCCAGGGTCAGCCCAGCTGGAGAAGCGGGAG
                    ************************************************************

HsCD00350499        TCAAAGGAACAGCAAGAGGACAGCTCAGCCACATCCTTCAGTGATCTTCCCCTCTACCTG
NM_015075.1         TCAAAGGAACAGCAAGAGGACAGCTCAGCCACATCCTTCAGTGATCTTCCCCTCTACCTG
NM_001111125.2      TCAAAGGAACAGCAAGAGGACAGCTCAGCCACATCCTTCAGTGATCTTCCCCTCTACCTG
                    ************************************************************

HsCD00350499        GATGACACAGTTCCCCAACAATCCCCTGAGCGACTGCCCAGCACAGAACCCCCACCCCAG
NM_015075.1         GATGACACAGTTCCCCAACAATCCCCTGAGCGACTGCCCAGCACAGAACCCCCACCCCAG
NM_001111125.2      GATGACACAGTTCCCCAACAATCCCCTGAGCGACTGCCCAGCACAGAACCCCCACCCCAG
                    ************************************************************

HsCD00350499        GGCCGGCCCGAGTTCTGGGCGCCAGCCCCTCTCCCGCCAGTTCCTCCACCAGTGCCATCA
NM_015075.1         GGCCGGCCCGAGTTCTGGGCGCCAGCCCCTCTCCCGCCAGTTCCTCCACCAGTGCCATCA
NM_001111125.2      GGCCGGCCCGAGTTCTGGGCGCCAGCCCCTCTCCCGCCAGTTCCTCCACCAGTGCCATCA
                    ************************************************************

HsCD00350499        GGAACCCGGGAAGACGGTAGCCGTGAGGAAGGCACTCGCAGGGGTCCCGGGTGCTTGGAG
NM_015075.1         GGAACCCGGGAAGACGGTAGCCGTGAGGAAGGCACTCGCAGGGGTCCCGGGTGCTTGGAG
NM_001111125.2      GGAACCCGGGAAGACGGTAGCCGTGAGGAAGGCACTCGCAGGGGTCCCGGGTGCTTGGAG
                    ************************************************************

HsCD00350499        TGCCGGGATTTCCGGCTGCGGGCTGCCCACCTTCCCCTGCTTACCATTGAGCCTCCTAGT
NM_015075.1         TGCCGGGATTTCCGGCTGCGGGCTGCCCACCTTCCCCTGCTTACCATTGAGCCTCCTAGT
NM_001111125.2      TGCCGGGATTTCCGGCTGCGGGCTGCCCACCTTCCCCTGCTTACCATTGAGCCTCCTAGT
                    ************************************************************

HsCD00350499        GACAGCTCCGTGGACCTGAGTGACCGCTCAGATCGCGGCTCTGTCCACCGCCAGCTGGTG
NM_015075.1         GACAGCTCCGTGGACCTGAGTGACCGCTCAGATCGCGGCTCTGTCCACCGCCAGCTGGTG
NM_001111125.2      GACAGCTCCGTGGACCTGAGTGACCGCTCAGATCGCGGCTCTGTCCACCGCCAGCTGGTG
                    ************************************************************

HsCD00350499        TATGAGGCTGATGGCTGCAGCCCCCATGGGACCCTGAAGCACAAGGGGCCACCAGGCAGG
NM_015075.1         TATGAGGCTGATGGCTGCAGCCCCCATGGGACCCTGAAGCACAAGGGGCCACCAGGCAGG
NM_001111125.2      TATGAGGCTGATGGCTGCAGCCCCCATGGGACCCTGAAGCACAAGGGGCCACCAGGCAGG
                    ************************************************************

HsCD00350499        GCCCCGATCCCACACCGCCACTACCCAGCCCCTGAAGGCCCAGCCCCAGCCCCACCAGGG
NM_015075.1         GCCCCGATCCCACACCGCCACTACCCAGCCCCTGAAGGCCCAGCCCCAGCCCCACCAGGG
NM_001111125.2      GCCCCGATCCCACACCGCCACTACCCAGCCCCTGAAGGCCCAGCCCCAGCCCCACCAGGG
                    ************************************************************

HsCD00350499        CCCCTGCCACCAGCCCCCAACAGTGGCACTGGGCCCAGTGGTGTGGCTGGGGGTCGGAGG
NM_015075.1         CCCCTGCCACCAGCCCCCAACAGTGGCACTGGGCCCAGTGGTGTGGCTGGGGGTCGGAGG
NM_001111125.2      CCCCTGCCACCAGCCCCCAACAGTGGCACTGGGCCCAGTGGTGTGGCTGGGGGTCGGAGG
                    ************************************************************

HsCD00350499        TTGGGGAAGTGCGAGGCAGCAGGCGAGAACTCTGATGGTGGAGATAACGAGAGCCTTGAG
NM_015075.1         TTGGGGAAGTGCGAGGCAGCAGGCGAGAACTCTGATGGTGGAGATAACGAGAGCCTTGAG
NM_001111125.2      TTGGGGAAGTGCGAGGCAGCAGGCGAGAACTCTGATGGTGGAGATAACGAGAGCCTTGAG
                    ************************************************************

HsCD00350499        AGCTCCAGCAATTCCAATGAGACCATCAACTGCAGCTCCGGCTCCTCTTCTCGGGACAGT
NM_015075.1         AGCTCCAGCAATTCCAATGAGACCATCAACTGCAGCTCCGGCTCCTCTTCTCGGGACAGT
NM_001111125.2      AGCTCCAGCAATTCCAATGAGACCATCAACTGCAGCTCCGGCTCCTCTTCTCGGGACAGT
                    ************************************************************

HsCD00350499        CTAAGGGAGCCTCCGGCTACCGGCCTGTGCAAGCAGACTTACCAGCGGGAGACAAGGCAT
NM_015075.1         CTAAGGGAGCCTCCGGCTACCGGCCTGTGCAAGCAGACTTACCAGCGGGAGACAAGGCAT
NM_001111125.2      CTAAGGGAGCCTCCGGCTACCGGCCTGTGCAAGCAGACTTACCAGCGGGAGACAAGGCAT
                    ************************************************************

HsCD00350499        AGCTGGGACTCGCCAGCTTTCAACAATGATGTGGTCCAGAGGCGGCACTACCGAATCGGC
NM_015075.1         AGCTGGGACTCGCCAGCTTTCAACAATGATGTGGTCCAGAGGCGGCACTACCGAATCGGC
NM_001111125.2      AGCTGGGACTCGCCAGCTTTCAACAATGATGTGGTCCAGAGGCGGCACTACCGAATCGGC
                    ************************************************************

HsCD00350499        CTCAACCTCTTCAACAAGAAGCCAGAGAAGGGTATCCAGTATCTGATCGAGCGGGGCTTC
NM_015075.1         CTCAACCTCTTCAACAAGAAGCCAGAGAAGGGTATCCAGTATCTGATCGAGCGGGGCTTC
NM_001111125.2      CTCAACCTCTTCAACAAGAAGCCAGAGAAGGGTATCCAGTATCTGATCGAGCGGGGCTTC
                    ************************************************************

HsCD00350499        CTGTCAGACACACCGGTGGGAGTGGCTCACTTCATCCTGGAGCGGAAAGGCCTCAGCCGG
NM_015075.1         CTGTCAGACACACCGGTGGGAGTGGCTCACTTCATCCTGGAGCGGAAAGGCCTCAGCCGG
NM_001111125.2      CTGTCAGACACACCGGTGGGAGTGGCTCACTTCATCCTGGAGCGGAAAGGCCTCAGCCGG
                    ************************************************************

HsCD00350499        CAGATGATAGGGGAATTCCTAGGGAACCGGCAGAAGCAGTTCAACAGAGACGTGTTGGAC
NM_015075.1         CAGATGATAGGGGAATTCCTAGGGAACCGGCAGAAGCAGTTCAACAGAGACGTGTTGGAC
NM_001111125.2      CAGATGATAGGGGAATTCCTAGGGAACCGGCAGAAGCAGTTCAACAGAGACGTGTTGGAC
                    ************************************************************

HsCD00350499        TGTGTGGTGGATGAGATGGACTTCTCCTCCATGGATCTGGATGATGCGCTCCGGAAGTTC
NM_015075.1         TGTGTGGTGGATGAGATGGACTTCTCCTCCATGGATCTGGATGATGCGCTCCGGAAGTTC
NM_001111125.2      TGTGTGGTGGATGAGATGGACTTCTCCTCCATGGATCTGGATGATGCGCTCCGGAAGTTC
                    ************************************************************

HsCD00350499        CAGTCCCATATCCGGGTTCAGGGTGAGGCCCAGAAAGTGGAGCGACTCATCGAAGCCTTC
NM_015075.1         CAGTCCCATATCCGGGTTCAGGGTGAGGCCCAGAAAGTGGAGCGACTCATCGAAGCCTTC
NM_001111125.2      CAGTCCCATATCCGGGTTCAGGGTGAGGCCCAGAAAGTGGAGCGACTCATCGAAGCCTTC
                    ************************************************************

HsCD00350499        AGCCAGCGGTACTGTGTCTGTAACCCAGCCCTCGTGCGCCAGTTCCGGAACCCAGACACC
NM_015075.1         AGCCAGCGGTACTGTGTCTGTAACCCAGCCCTCGTGCGCCAGTTCCGGAACCCAGACACC
NM_001111125.2      AGCCAGCGGTACTGTGTCTGTAACCCAGCCCTCGTGCGCCAGTTCCGGAACCCAGACACC
                    ************************************************************

HsCD00350499        ATCTTCATCCTTGCTTTTGCCATCATCCTCCTCAATACCGACATGTACAGTCCCAGCGTC
NM_015075.1         ATCTTCATCCTTGCTTTTGCCATCATCCTCCTCAATACCGACATGTACAGTCCCAGCGTC
NM_001111125.2      ATCTTCATCCTTGCTTTTGCCATCATCCTCCTCAATACCGACATGTACAGTCCCAGCGTC
                    ************************************************************

HsCD00350499        AAAGCTGAACGAAAGATGAAACTAGATGACTTCATCAAGAACCTGAGAGGGGTTGACAAT
NM_015075.1         AAAGCTGAACGAAAGATGAAACTAGATGACTTCATCAAGAACCTGAGAGGGGTTGACAAT
NM_001111125.2      AAAGCTGAACGAAAGATGAAACTAGATGACTTCATCAAGAACCTGAGAGGGGTTGACAAT
                    ************************************************************

HsCD00350499        GGTGAAGACATCCCCCGAGACCTCCTGGTGGGCATCTACCAGCGCATCCAGGGGCGTGAA
NM_015075.1         GGTGAAGACATCCCCCGAGACCTCCTGGTGGGCATCTACCAGCGCATCCAGGGGCGTGAA
NM_001111125.2      GGTGAAGACATCCCCCGAGACCTCCTGGTGGGCATCTACCAGCGCATCCAGGGGCGTGAA
                    ************************************************************

HsCD00350499        CTGCGGACCAACGATGACCATGTGTCCCAGGTGCAGGCTGTGGAGCGCATGATTGTTGGA
NM_015075.1         CTGCGGACCAACGATGACCATGTGTCCCAGGTGCAGGCTGTGGAGCGCATGATTGTTGGA
NM_001111125.2      CTGCGGACCAACGATGACCATGTGTCCCAGGTGCAGGCTGTGGAGCGCATGATTGTTGGA
                    ************************************************************

HsCD00350499        AAGAAACCAGTCCTGTCTCTCCCTCACCGTCGACTGGTTTGCTGCTGCCAGCTCTACGAG
NM_015075.1         AAGAAACCAGTCCTGTCTCTCCCTCACCGTCGACTGGTTTGCTGCTGCCAGCTCTACGAG
NM_001111125.2      AAGAAACCAGTCCTGTCTCTCCCTCACCGTCGACTGGTTTGCTGCTGCCAGCTCTACGAG
                    ************************************************************

HsCD00350499        GTGCCAGATCCAAACCGCCCCCAGAGGCTAGGGTTGCATCAGCGGGAGGTCTTCCTCTTC
NM_015075.1         GTGCCAGATCCAAACCGCCCCCAGAGGCTAGGGTTGCATCAGCGGGAGGTCTTCCTCTTC
NM_001111125.2      GTGCCAGATCCAAACCGCCCCCAGAGGCTAGGGTTGCATCAGCGGGAGGTCTTCCTCTTC
                    ************************************************************

HsCD00350499        AATGATCTCCTTGTGGTCACCAAAATTTTCCAGAAGAAGAAGATCTTGGTGACGTACAGT
NM_015075.1         AATGATCTCCTTGTGGTCACCAAAATTTTCCAGAAGAAGAAGATCTTGGTGACGTACAGT
NM_001111125.2      AATGATCTCCTTGTGGTCACCAAAATTTTCCAGAAGAAGAAGATCTTGGTGACGTACAGT
                    ************************************************************

HsCD00350499        TTCCGTCAGTCTTTCCCCCTCGTGGAAATGCACATGCAGCTCTTCCAGAATTCATATTAC
NM_015075.1         TTCCGTCAGTCTTTCCCCCTCGTGGAAATGCACATGCAGCTCTTCCAGAATTCATATTAC
NM_001111125.2      TTCCGTCAGTCTTTCCCCCTCGTGGAAATGCACATGCAGCTCTTCCAGAATTCATATTAC
                    ************************************************************

HsCD00350499        CAGTTTGGGATCAAGTTGCTGTCTGCAGTACCTGGTGGGGAGCGAAAAGTCCTCATCATC
NM_015075.1         CAGTTTGGGATCAAGTTGCTGTCTGCAGTACCTGGTGGGGAGCGAAAAGTCCTCATCATC
NM_001111125.2      CAGTTTGGGATCAAGTTGCTGTCTGCAGTACCTGGTGGGGAGCGAAAAGTCCTCATCATC
                    ************************************************************

HsCD00350499        TTCAATGCCCCCAGCCTCCAGGACCGGCTGCGCTTTACATCCGACCTGCGCGAGTCCATT
NM_015075.1         TTCAATGCCCCCAGCCTCCAGGACCGGCTGCGCTTTACATCCGACCTGCGCGAGTCCATT
NM_001111125.2      TTCAATGCCCCCAGCCTCCAGGACCGGCTGCGCTTTACATCCGACCTGCGCGAGTCCATT
                    ************************************************************

HsCD00350499        GCGGAGGTGCAGGAGATGGAGAAATACCGTGTGGAGTCGGAGCTGGAGAAGCAGAAAGGT
NM_015075.1         GCGGAGGTGCAGGAGATGGAGAAATACCGTGTGGAGTCGGAGCTGGAGAAGCAGAAAGGT
NM_001111125.2      GCGGAGGTGCAGGAGATGGAGAAATACCGTGTGGAGTCGGAGCTGGAGAAGCAGAAAGGT
                    ************************************************************

HsCD00350499        ATGATGCGGCCTAACGCCTCACAGCCTGGAGGGGCCAAGGACTCAGTGAATGGGACGATG
NM_015075.1         ATGATGCGGCCTAACGCCTCACAGCCTGGAGGGGCCAAGGACTCAGTGAATGGGACGATG
NM_001111125.2      ATGATGCGGCCTAACGCCTCACAGCCTGGAGGGGCCAAGGACTCAGTGAATGGGACGATG
                    ************************************************************

HsCD00350499        GCCCGCAGTAGCCTGGAGGACACTTACGGGGCAGGCGATGGGCTCAAACGGGGCGCACTC
NM_015075.1         GCCCGCAGTAGCCTGGAGGACACTTACGGGGCAGGCGATGGGCTCAAACGGGGCGCACTC
NM_001111125.2      GCCCGCAGTAGCCTGGAGGACACTTACGGGGCAGGCGATGGGCTCAAACGGGGCGCACTC
                    ************************************************************

HsCD00350499        AGCAGTTCCCTGCGAGACCTCTCTGATGCAGGGGTCTGTTATTAA---------------
NM_015075.1         AGCAGTTCCCTGCGAGACCTCTCTGATGCAGGGGTCTGTTATTAG---------------
NM_001111125.2      AGCAGTTCCCTGCGAGACCTCTCTGATGCAGGGAAGCGGGGGCGGCGTAACAGCGTGGGA
                    *********************************.:  *  .  ..               

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      TCGCTGGACAGCACCATCGAAGGGTCTGTTATTAGCAGTCCACGCCCTCACCAGAGGATG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CCACCTCCGCCCCCACCCCCGCCGCCAGAGGAGTACAAGAGCCAGAGGCCCGTCTCCAAC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      TCCTCATCCTTCCTGGGCTCCCTATTTGGAAGCAAGCGGGGCAAGGGGCCCTTCCAGATG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CCACCACCGCCAACAGGCCAGGCCTCTGCCTCCTCTTCATCTGCTTCTTCCACGCACCAC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CACCACCACCACCACCATCATGGCCATAGCCACGGTGGCCTGGGGGTGCTGCCTGATGGG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CAGTCCAAGCTCCAGGCCCTGCATGCCCAGTATTGCCAAGGACCGGGCCCTGCCCCGCCA
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CCCTACCTCCCACCCCAGCAGCCCTCTCTTCCCCCACCTCCCCAGCAGCCCCCACCCTTG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CCCCAGCTGGGCTCCATTCCACCGCCTCCCGCCTCAGCCCCACCTGTGGGGCCACATCGC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CACTTCCACGCCCATGGCCCAGTCCCAGGGCCCCAACACTATACCTTGGGCCGGCCAGGC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      AGGGCACCCAGACGGGGGGCTGGAGGACACCCTCAGTTTGCTCCACATGGCCGCCACCCC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CTGCACCAGCCCACATCCCCACTGCCCCTGTACAGTCCTGCCCCCCAGCACCCTCCAGCC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CACAAACAGGGCCCTAAGCACTTCATCTTCAGCCACCACCCACAGATGATGCCAGCAGCA
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      GGCGCGGCTGGGGGCCCTGGATCCCGGCCACCAGGGGGCTCCTACTCCCACCCCCACCAC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CCCCAGTCACCATTGTCACCACACTCACCCATCCCACCCCACCCCTCCTATCCACCCCTC
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CCCCCACCCTCCCCTCACACCCCGCACTCACCCCTTCCACCCACCTCCCCCCATGGCCCG
                                                                                

HsCD00350499        ------------------------------------------------------------
NM_015075.1         ------------------------------------------------------------
NM_001111125.2      CTGCACGCCTCTGGGCCCCCTGGCACAGCCAACCCCCCCAGTGCAAACCCCAAGGCCAAG
                                                                                

HsCD00350499        ---------------------------
NM_015075.1         ---------------------------
NM_001111125.2      CCAAGCCGGATCAGCACCGTGGTCTGA
                                               

Protein

SMART domain : Sec7 : Sec7 domain
SMART domain : PH : Pleckstrin homology domain.
UniProt : Q5JU85
HPRD : 10012

Clone

Cloning Information : 563106

Organism


TAX_ID : 9606
Species Specific ID: 23096

Genome

Chromosome : X
Map Location : Xp11.22
Ensembl : ENSG00000124313

Reagents

Labome : IQSEC2-antibody